Enterprise and Innovation Free Essay Example, 3000 words

In other words, they are concerned with economic development of the country. Thus, in order to improve business practices, entrepreneurs can be exploited to bring in new and innovative ideas to increase profitability margins for the company (Kuratko 2013). A company can increase its share value by either focusing on profitability by monetary gain and also by focusing on non-monetary worth i. e. building and sustaining Goodwill to enhance its business activities (Trehan and Treha 2009 p. 196). Focus on building and sustaining Goodwill In order to increase market share, entrepreneurs shall be encouraged to focus on building the Goodwill for the company. This can be carried out by focusing on training entrepreneurs in customer service and sales department. In this regard, it is vital to state the goodwill can only be established if the company provides excellent goods and services to its customers, where the staff is polite and courteous, and there is quick, convenient delivery of their products. These traits shall help the organization become a recognized brand name, and its goodwill shall increase (Tremblay and Tremblay 2012, p. 394). Entrepreneurs need to be devoted to the company, to stay active, polite in order to build goodwill. We will write a custom essay sample on Enterprise and Innovation or any topic specifically for you Only $17.96 $11.86/pageorder now Focus on sales and profitability In order to gain sales and increase profitability, the company needs to focus on developing a productive workforce that works with innovation in marketing and sales department to promote the products of the company. In this regard, the entrepreneurs need to be encouraged by the management to work with devotion (Birn, 2004 p. 185). The following steps can be taken by the management to encourage entrepreneurship to enhance profitability, increase sales and gain market share. Ways to encourage Entrepreneurship Focusing on Organizational culture Entrepreneurship can be encouraged if they are given an effective working environment where they are inspired to work with devotion and commitment. A good corporate culture would not just make the environment relaxing but encourage creativity, and cultivate the mind towards developmental opportunities which are very essential for personal and professional growth (Davila et al. 2007). Employee Engagement In order to encourage entrepreneurs, the company shall install effective engagement processes where key employees would be required to communicate and give their opinions about various decisions taking place in the organization. This engagement process shall help young entrepreneurs explore themselves and communicate ideas for learning opportunities.

Exploring Aspects of the Alzheimer’s Disease Essay

Over four million Americans have been diagnosed with Alzheimer’s disease (1). One of those is my grandfather. He has suffered from Alzheimer’s for almost 8 years. I have watched my grandfather slowly decline and forget things such as where he lived, my name, and even how to talk. Many times I was upset and confused and often puzzled at the way he acted. I knew something was seriously wrong because he could never remember anything and often had tears in his eyes. I felt angry when he didn’t remember who I was. Eventually, he could no longer put together a sentence that made sense and he relied on others for total care. We have been forced to place him in a nursing home, and watch him†¦show more content†¦When he dissected her brain, he discovered coiled deposits around the nerve cells, called neuritic plaques. He also discovered twisted bands of fibers, or neurofibrillary tangles, inside the nerve cell in the brain. However, even after this disc overy, the disease still wasn’t recognized as a major disease until 1970, when neurological research began to expand. This degenerative brain disorder has since, been named after Dr. Alzheimer. Even today, doctors use the same technique that Dr. Alzheimer used to observe the plaques and tangles in the brain. (2) Studies show that the risk of developing Alzheimer’s disease increases with age. Almost 20 percent of Americans between the years of 75 and 84, and almost half of those that are 85 years and older suffer from Alzheimer’s disease (3). One out of every 10 persons that are 65 years of age and older are said to be victims of Alzheimer’s disease, yet even some early-onset victims might be in their 40s and 50s (4). Many believe that if an individual develops Alzheimer’s at an early age, it is related to genetics. Yet, still others believe that Alzheimer’s that develops at a later age, is related to genetics as well. A mutation on chromosome 19 has been linked with a later onset of Alzheimer’s disease, but not everyone that has the mutation develops the disease (5). Therefore, the parallelShow MoreRelatedThe Human Of Human Genome Project995 Words   |  4 Pagesfor diseases. It guided the medical field to new direction but at the same time created new challenges and problems. The primary objective of the project isn’t wrong or questionable but some believe its implications are. Genes are made of a molecule called DNA (deoxyribonucleic acid) which contains the instructions for making every protein in the body. By studying and understanding the genome system completely, we will be able to shed some light on how to diagnose and treat chronic diseases at anRead Mor e Anosmia Essay1649 Words   |  7 Pages(Toller, 1999). On the other hand, some people will constantly eat trying to satisfy their need for taste and put on an excess of unhealthy weight. Another issue to consider when discussing anosmia is safety. Probably one of the most important safety aspects of all people is the ability to smell fire. Anosmics may be in greater danger with these situations. They should be encouraged to check the batteries in their smoke detectors often, and consider having their natural gas checked by a professional monthlyRead MoreMy Hero In My Life720 Words   |  3 Pagesextended into all aspects of my life beginning with my family’s deep medical history. Throughout my life, I have seen the walls of a hospital one too many times for a series of family medical emergencies. My first experience was when my father suffered a sudden heart attack. I remember being very young but in a state of confusion mixed with the fear of losing him. I kept think ing about how this could have happened and what could have been done to prevent this. With heart disease, came a mandatoryRead MoreAn Overview of Alzheimers Disease and Dementia Essay1938 Words   |  8 PagesAlzheimer’s Disease Dementia Intro/Overview Section of Disease Paper â€Å"Horribly tragic, scary, slow, sad, maddening, etc.† These are words some would use when asked what Alzheimer’s/dementia is. This answer is common to those who have watched loved ones suffer from this disease that ultimately lead to their passing. As defined in McGraw Hill Medical Dictionary, Alzheimer’s Disease is a ‘progressive neurologic disease of the brain that causes irreversible loss of neurons and eventualRead MoreInformative Essay About Dance Therapy1515 Words   |  7 Pagesthe second group consisted of people who suffered from genetic diseases and severe psychomotor retardation, and the third group was the elderly. The first group (ages 26+) were patients who suffered from intellectual disabilities like motor disorder as a consequence of cerebral palsy, speech impairment, auditory function, and difficulties with motor skills. The second group (ages 26-50) had individuals who suffered from a genetic disease and severe psychomotor retardatio n. The third group was olderRead MoreSymptoms And Symptoms Of Alzheimer s Disease2317 Words   |  10 Pagesis an inevitable process that every human being goes through. It is very important to see how people change as they age and the various experiences they go through. One of the most common diseases among older people is dementia. Among the different types of dementia, the most prevalent one is Alzheimer’s disease (AD). It is important to look at all of the signs and symptoms of each type of dementia to see which specific type best describes a person’s condition. There is one patient in particular,Read MoreThe Ethics of Cloning Essay1504 Words   |  7 Pagesthis paper the reasoning behind why cloning is an acceptable and potentially life changing science will be examined. Along with this we will take a close look at the arguments against cloning and exploring the flaws within the argument. This will affirm that cloning is useful because it cures diseases, pass es on genes, and repopulates endangered species. In order to have a legitimate argument for the reasoning why cloning is or is not acceptable it is important first to be understand what exactlyRead MoreGenetic Testing And Mental Health Disorders1039 Words   |  5 PagesHuntington’s disease through human genome and family research. Diagnostic and presymptomatic testing is available by discovering a gene mutation for Huntington Disease (HD) and prepares persons who are at risk for Huntington Disease (HD) to ask for genetic testing. A multi-visit protocol is enacted when HD genetic testing is offered through HD testing centers, followed by education and counseling for those requesting to have HD gene testing. I will use this paper to define Huntington’s disease, choreaRead MoreAlzheimers Disease Essay1677 Words   |  7 PagesTITLE ABSTRACT Alzheimer’s Disease (AD) has been implicated with two major pathologies, the accumulation of amyloid-B and tau phosphorylation (_). These pathologies have long been implicated with the gene Alipoprotein E (ApoE) which continually showed a dosage-dependent effect on amyloid-B clearance (_). Many studies have shown correlated linkage between ApoE and tau as well as their possible interactions (_). Tau phosphorylation has continually been found among many AD patients sufferingRead MoreThe American Heart Association Scientific Advisory2236 Words   |  9 Pagesbyproduct of protein metabolism, which damages the epithelium and increases the risks of cognitive decline (Sears 51). Likewise, a 2012 meta-analysis of seven randomized control trials (RCTs) estimated that a ten percent reduction in coronary heart disease was linked to each five percent energy increase in PUFA consumption (â€Å"Essential†). Furthermore, results of cell culture and animal studies suggest that n-3 fatty acids can modulate the expression of genes, including those involved with fatty acid

Skema Answer Manufacturing Proces 1 Free Essays

FACULTI OF MECHANICAL ENGINEERING UNIVERSITI MALAYSIA PAHANG BMM3643 (SEM II_2012-13) Assignment #1 1. a) What metals are frequently cast into products? b) What materials are used to produce the expendable patterns for investment casting? c) Explain why a casting may have to be subjected to various heat treatments. (8 marks) Answer a) Cast parts can range in size from a fraction of an inch and a fraction of an ounce to over 30 feet and many tons. We will write a custom essay sample on Skema Answer Manufacturing Proces 1 or any similar topic only for you Order Now Moreover, casting can incorporate complex shapes, hollow sections or internal cavities, and irregular curved surfaces. b) In investment casting a pattern is formed from a low melting temperature, low vaporization temperature material, often wax. The mold is produced by surrounding the pattern with the mold material. The mold cavity is produced when the pattern is removed by melting/vaporizing the pattern. In early process development with porous mold materials the melted wax from the pattern would migrate into the mold material and be lost. ) Heat treatments (described in Chapter 4) such as quenching and tempering, among others, are carried out to optimize the grain structure of metal castings, thereby controlling and enhancing mechanical properties. Heat treating can control microporosity, which is a main reason that castings are weak in tension. 2. a) What are some of the attractive features of die casting compared to alternative casting methods? b) For the cast metal wheel illustr ated in Figure below, show how (a) riser placement, (b) core placement, and (c) chills may be used to help feed molten metal and eliminate porosity in the isolated hub boss. ) What are some of the general defects encountered in casting processes? Name and briefly describe three. (8 marks) Answer a) Die casting is characterized by extremely smooth surface finishes, excellent dimensional accuracy, and high production rates. A single set of dies can produce many thousand castings without significant changes in dimension. b) Solutions; i) Riser ii) Core iii) Chills c) General defects include; v) misruns, in which the casting solidifies before filling the mold cavity v) cold shuts, in which two portions of metal flow together but there is lack of fusion at the joint; vi) cold shots, where solid globules of cast metal become entrapped in the casting; vii) shrinkage cavity, which is a depression on the casting surface or an internal void in the casting caused by solidification shrinkage; v iii) microporosity, which is a network of small voids throughout the casting caused by localized solidification shrinkage; and ix) hot tearing, which is a crack in the casting caused by a mold that does not ield to the metal during the early stages of solidification shrinkage. 3. a) How does the fabrication of a thermoplastic polymer differ from the processing of a thermosetting polymer? b) What are the significant differences in the equipment and operating procedures between injection mold- ing of thermoplastics and injection molding of thermosets? c) Can thermosetting plastics be used in injection molding? Explain. (8 marks) Answer a) Thermoplastic polymers can be heated to a temperature at or near the melting temperature so that the material becomes either a formable solid or a liquid. The polymer can than be cast, injected into a mold, or forced through a die to produce the desired shape. With thermosetting polymers, once the polymerization has occurred, no further deformation can occur. Thus, the polymerization reaction and the shape-forming process must be accomplished simultaneously. b) The differences in injection molding of thermosets are (1) shorter barrel length, (2) lower temperatures in the barrel, these first two reasons to prevent premature curing; and (3) use of a heated mold to cause cross-linking of the TS polymer. c) Thermosetting plastics are suitable for injection molding. The basic modification which must be made to the process is that the molds must be heated to allow polymerization and crosslinking to occur in the mold cavity. The major drawback associated with this change is that, because of the longer cycle times, the process will not have as high a production rate as injection molding of thermoplastics. 4. a) Identify one injection molding process could be used to inject a single part with two or more different material as shown below. b) Describe process mechanism c) List and explain THREE (3) advantages of this technology? (8 marks) Answer a) Multi-shot injection molding ) This process ables to to shoot two or more different materials into the same mold, into different locations, resulting in parts with increased functionality, improved cosmetics, and multiple mechanical properties. c) Advantages; i) Reduced cycle time * Compared to multiple molding cycles of separate components, molding multiple materials in the same cycle has obvious time and labor benefits. ii) Reduced part cost * Combine reduced cycle times, reduced labor times, and eliminated assembly operations, and the total cost of multi-shot molded parts becomes less, compared to alternative single-shot methods. ii) Improved Adhesion * With multi-shot molding we get a true physical bond, resulting in a much stronger, longer lasting bond, compared to more traditional â€Å"skin on skin† insert molding or post-molding assembly. 5. d) What are sheet-molding compounds (SMCs)? Bulk-molding compounds (BMCs)? e) What are some of the forms in which reinforcement fibers appear in composite materials? f) Describe the problems involved in recycling products made from reinforced plastics. (8 marks) Answer a) Sheet molding compounds are sheets composed of chopped fibers and resin, the sheets being about 0. inch in thickness. These can be press-formed in heated dies to provide an alternative to sheet metal where light weight, corrosion resistance and integral color are desired. Bulk-molding compounds are fiber-reinforced thermoset molding materials containing short fibers in random orientation. They are formed into products using processes like compression molding, transfer molding or injection molding. b) Fiber-reinforced composites use the strength of the fibers to impart additional strength to the fiber-matrix whole. The use of fibers means that added strength will be in the fiber length direction. The commonly used fiber forms are; i) long, continuous fibers are their use results in increased strength in the fiber length direction, ii) fibers woven into fabric layers used in thin sheet composites and they add strength in the two in-plane fiber directions, iii) woven fabrics of fibers formed in three dimensions so that when embedded in the matrix strength in three dimensions is increased, iv) short, chopped fibers that can be oriented in a particular direction or randomly. ) The main problems are that recycling usually requires the use of a single type of material, and that some plastics (mainly hard and brittle polymers) are more difficult to chop into small pieces for further processing than others. With reinforced plastics, this requires that the reinforcement be separated from the matrix, a very difficult task and uneconomical task. Note that matrices are often thermosets, so it is not practi cal to melt the matrix and separate the fibers from a molten phase. 6. ) In the casting of steel under certain mold conditions, the mold constant in Chvorinov’s Rule is known to be 4. 0 min/cm2, based on previous experience. The casting is a flat plate whose length =30cm, width =10cm, and thickness =20 mm. Determine how long it will take for the casting to solidify. h) A round bar of 15-mm diameter is extruded from a single-screw extruder of 100 mm barrel diameter. The material is LDPE. Calculate; i) The approximate flow rate (kg/h), ii) Speed of emerging extrusion Given : Density LDPE = 0. 92 g/cm3) (10 marks) Answer a) Volume V = 30 x 10 x 2 = 600 cm3 Area A = 2(30 x 10 + 30 x 2 + 10 x 2) = 760 cm2 Chvorinov’s Rule: TTS = Cm (V/A)2 = 4(600/760)2 = 2. 493 min b) R i) Flow rate, qe= CeDscr = 0. 006(100)2. 3 = 238. 86 kg/h ii) Density, ? = 0. 92 g/cm3 Cross-sectional area = (152*? )/4 = 1. 767cm2 Volume = 238. 86 / 0. 92 = 259635cm3/h = 72. 12cm3/s Extrusion speed = 72. 12 / 1. 767 = 40. 8 cm/s ****************************************************** How to cite Skema Answer Manufacturing Proces 1, Papers

Pro Capital Punishment Essay Example For Students

Pro Capital Punishment Essay What is capital punishment? Capital punishment is the maximum penalty of aconviction. More than 4, 400 people have been executed since 1930. There is noway of knowing how many people have been executed in U.S. history because theyused to be local affairs with nobody to record them. On the edge of the 21stcentury, Capital punishment is still one of the two most debated issues in theU.S., the other is abortion. This paper will attempt to show the effects ofcapital punishment and how it is used. Capital punishment has been a veryattention grabbing incident over the years. For example, in 1936, about 20,000people gathered in Owensboro, Kentucky, on the morning of August 14 to see thehanging of a 22 year old black man, Rainey Bethea. Many people have also diedwrongfully. Sacco and Vangetti were two Italian immigrants that were accused ofpayroll robbery. Although they had alibis of there whereabouts, they were stillconvicted of the crime and sentenced to death by the electric chair. Nearly every culture throughout history has practiced capital punishment. Quarteringwas a popular method in Europe. Quartering is being torn apart by horses. InIndia, executions were sometimes carried out by having an elephant crush thecondemneds head. In modern times, societies have sought to make executionsmore humane. Such was the goal of the guillotine, which severed thecondemneds head with a heavy blade, and the electric chair which kills with amassive dose of electrical current. The Constitution of the United Statesguarantees to every citizen certain fundamental rights. The First Amendment, forexample guarantees freedom of religion, speech, press, assembly, and petition. The Second Amendment promises that the right of the people to keep and beararms shall not be infringed. The amendment most relevant to the issue of thedeath penalty is the Eighth Amendment. It reads: Excessive bail shall not berequired, nor excessive fines imposed, nor cruel and unusual punishmentinflicted. However simple and straightforward these words may sound, its notalways clear what they mean. That is because the words cruel and unusual aresubjective. One person may think, for instance, that capital punishment is crueland unusual, while another person may not. In 1972, the Supreme Court declaredthe death penalty cruel and unusual, and therefore unconstitutional. It was soonreactivated in 1976 by 35 states. People have tried to influence decisions onthe death penalty. For example, the Pope has played a role in the decision ofthe death penalty. The Pope pleaded for a criminals life and the criminal wassentenced to life in jail instead of the electric chair. Many people that arein nocent have been sentenced to death. Harry Blackman, a death penalty opponent,stated Innocent persons have been executed and will continue to beexecuted, explaining why he could no longer support the death penalty. Isidore Zimmerman, came within 2 hours of execution for a murder he did notcommit. Citing instances like this, death penalty opponents claim that thedanger of a terrible and irrevocable mistake capital punishment intolerable. Cost often comes up when the death penalty is mentioned. Those in favor of thedeath penalty say the government shouldnt waste its money on guarding,feeding, and housing a depraved criminal for the rest of his or her life. Thetruth is, however, that it costs much more to put a prisoner to death than tokeep a prisoner in jail. It cost about 2 million to 3 million dollars tosentence someone to death and keep them on death row for 8 years. The same itcosts to keep 3 prisoners in a maximum security prison for 40 years. Opponentsuse this as a contradiction. Race is a big issue in death sentencing althoughnot admitted. There is still a lot of hard decision making when it comes toethnics being punished. A comprehensive examination of capital murder casesin Georgia, a black convicted of murdering a white has a 22 percent chance ofbeing sentenced to die, whereas a white convicted of murdering a black has onlya 3 percent chance. This has been a big thing in the civil issues in America. .u8c66ebbfe2ebcf68b6d14745d1b068f7 , .u8c66ebbfe2ebcf68b6d14745d1b068f7 .postImageUrl , .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text-area { min-height: 80px; position: relative; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 , .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover , .u8c66ebbfe2ebcf68b6d14745d1b068f7:visited , .u8c66ebbfe2ebcf68b6d14745d1b068f7:active { border:0!important; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .clearfix:after { content: ""; display: table; clear: both; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:active , .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text-area { width: 100%; position: relative ; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover .ctaButton { background-color: #34495E!important; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .u8c66ebbfe2ebcf68b6d14745d1b068f7-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:after { content: ""; display: block; clear: both; } READ: Juveniles And The Death Penalty (1498 words) EssayWhen the death penalty is actually brought out to the society, basicallyeverything has an a effect on it. Religion, race, cost, and morals, but it isstill used in America today. Many democratic countries have outlawed the deathpenalty and the U. S. probably should too. The Pope of the Catholic Church oncesaid, Only God has the Power to give and take life from someone. Thisbeing true to most people, but the government and the American society have todecide whether or not to keep capital punishment.

Foreign Debt Crisis Management free essay sample

The topic of assignment is to study the debt crisis management and impact of un-hedged exposure aspects of RCom – a major Telecom Service provider in India. RCom has entered in high-debt levels i. e Rs 35000 crore and it has been further compounded because of the steep depreciation of the rupee, where nearly three-fourths of Loan is in foreign currency. RCom has implemented refinancing strategy for the loan outstanding by Industrial and Commercial Bank of China (ICBC), China Development Bank (CDB), Export Import Bank of China (EXIM), and other banks. This strategy will be benefited from extended loan maturity of seven years and attractive interest cost of about 5 per cent and the loan would be used for refinancing the entire redemption amount of FCCB. In this assignment, I have studied the financial crisis management part which is managed by the company with some strategic move of loan refinancing and a smart move of fund raising through listing of Flag telecommunication at Singapore and set an indicative price range for the Singapore initial public offering of its undersea cable unit (Flag Telecommunication) that could raise as much as $1 billion and help to reduce its debt load. We will write a custom essay sample on Foreign Debt Crisis Management or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page I have also studied the impact of heavy debt on companys financial credit worthiness and impact of rupee devaluation on overseas loan taken from China and loss incurred due to huge exposure of un-hedged transactions. Reliance Communications Limited is the flagship Company of Reliance Group, one of the leading business houses in India. Reliance Communications is India’s foremost and truly integrated telecommunications service provider. The Company, with a customer base of 152 million as on March 31, 2012 including over 2. million individual overseas retail customers, ranks among the Top 4 Telecom companies in the world by number of customers in a single country. Reliance Communications corporate clientele includes over 35,000 Indian and multinational corporations including small and medium enterprises and over 800 global, regional and domestic carriers. Reliance Communications has established a pan-India, next generation, integrated (wireless and wire line), convergent (voice, data and video) digital network that is capable of supporting best-of-class services spanning the entire communications value chain, covering over 24,000 towns and 600,000 villages. Reliance Communications owns and operates the world’s largest next generation IP enabled connectivity infrastructure, comprising over 277000 kilometers of fiber optic cable systems in India, USA, Europe, Middle East and the Asia Pacific region. Assignment analysis and study RCom has entered in high-debt levels i. e Rs 35000 crore because of high capital investment for changes in industry landscape, rapid emergence of newer business opportunities like 3G, mobile broadband data, etc, and evolving regulatory framework. RCom continues to actively evaluate and execute the most relevant organization structure to address the market opportunity. In the 2 years, RCOM has taken several measures to reduce its mounting debts. 1. Reliance Communications has secured loans from a host of Chinese banks to refinance $1. 18 billion worth of outstanding foreign currency bonds due for redemption. The deal has provided RCOM a major support, where company is trying for more than a year to sell its telecoms tower unit to cut the companys about $6. 5 billion debt. Reliance Communications said Industrial and Commercial Bank of China, China Development Bank Corp, Export Import Bank of China and other banks were funding the refinancing of the outstanding foreign currency convertible bonds (FCCBs). The company said it would benefit from extended loan maturity of seven years and attractive interest cost of about 5 percent, sending its shares up as much as 5. 7 percent in a Mumbai market that rose 1. 5 percent. The FCCBs were issued in February 2007 when the Indian markets were booming, with a conversion price of 654 rupees a share. Cut-throat competition among Indias mobile phone operators has since hit earnings and shares have plunged. Reliance Communications shares were trading around 90 rupees, a fraction of the conversion price. Reliance Communications has talked with China Development Bank for a syndicated loan to redeem the bond. China Development Bank arranged loans worth $1. 93 billion for Reliance Communications, which the company used to finance radio airwaves it acquired during a costly 3G auction, as well as for the purchase of equipment. With its bruising debt load and a ferociously competitive 15-operator arket, Reliance Communications has reported eight straight quarters of falling profits. Reliance communications has tried once again and talked with U. S. buyout giants Carlyle Group and Blackstone Group on a deal for the towers business which could be worth more than $3 billion, but unfortunately the deal is not closed to completion. 2. RCom has filed a prospectus with the Singapore Stock Exchan ge and plans to divest as much as 75% stake in Flag Telecom to raise about $1 Billion- Reliance Communications was looking to secure a leasing agreement for its towers from Reliance Industries, before pressing forward with a tower sale. It has also not settled. The efforts to sell a majority stake in Reliance Infratel are still to fructify, in the mean time company has decided the listing of Reliance Globalcom. , where the Reliance Globalcom can help the company to raise Rs 50 billion-Rs 65 billion by divesting 75 per cent stake in its submarine cable business. The issue has opened at a price range of $1. 09-$1. 32 per unit. The bankers for the issue include Deutsche Bank, DBS of Singapore, Standard Chartered and the Industrial and Commercial Bank of China. Reliance Globalcom will be listed under the business trust structure. Post the listing, the company’s submarine assets and business will continue to be controlled by the existing management. RCOM will continue to hold the remaining 25 per cent equity stake. A. Background of Reliance Globacom Reliance Globalcom was formed in 2003 as a result of an amalgamation of Flag Telecom with the Reliance Group for $207 million. Flag, which had emerged from bankruptcy proceedings and had been on the block for over a year before being acquired by Reliance, was reeling under losses. However, the acquisition gave Reliance a foothold in the global business arena with over 50,000 km of submarine cables, thereby ending Tata Communications’ monopoly in the undersea cable field. From 2005, Flag embarked on an expansion path and finally broke even in September 2006. It introduced several higher-value-added products, including international private leased circuits (IPLCs), virtual private networks (VPNs) and Ethernet services. This accelerated the company’s revenue growth and increased its profitability. Flag Telecom later came into the fold of RCOM, led by Anil Ambani, after the Reliance Group’s businesses were split between the brothers, Mukesh and Anil Ambani. In 2008, the company was integrated into RCOM’s international operations under the Reliance Globalcom brand. B. Cable network of Flag Telecom Reliance Globalcom owns the largest private cable network in the world with over 277,000 route km of fibre optic cables. This includes 68,000 km of subsea fibre. Through strategic relationships with over 750 network service providers across the world, Reliance Globalcom provides assured connectivity to 163 territories worldwide. This makes RCOM a carrier’s carrier as it provides global connectivity solutions to carriers and internet communities through its submarine cable system. The company has cable landing tie-ups across 46 locations in 26 countries with 31 partners. The company’s global backbone spans four continents, connecting key business markets in Asia, Europe, the Middle East and the US. The network consists of five cable systems – FLAG Europe Asia (FEA), FLAG North Asian Loop (FNAL), FLAG Atlantic 1 (FA-1), FLAG Alcatel-Lucent Optical Network (FALCON) and HAWK. The company also owns and operates a low latency, global MPLS-based IP network, which connects most of the world’s principal international internet exchanges. FNAL represents a part of the 9,800 km North Asian Loop submarine, an intra-Asia submarine cable system that links Japan, Korea, Taiwan and Hong Kong in a ring configuration. The entire FNAL submarine cable system consists of six pairs of fibre, three of which are owned by Reliance Globalcom.

Documentary Research

Documentary Research Introduction Documentary research is a type of academic research that employs the use of source materials such as documents and texts for studying a specific research topic. Source materials used in this form of research may include newspapers, census results, story books, government publications, diaries, videos, works of art certificates visual and photographic items done on paper and so on.Advertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Documentary research is the most commonly used type of research document amongst the three major social research methods (Scott 1990). Literature review on the other hand refers to a given body of secondary text of an existing document. These documents can either be published or unpublished documents meant to review important points of knowledge needed to carry out comprehensive findings to a given research topic. It gives an general idea of both theory and methodology of a specific research topic (Hart 2001). Discussion Documentary research process employs the use of conceptualizing methods in document review and use. It involves the use of ether qualitative or quantitative research analysis skills, or it may sometimes employ the use of both techniques to study a specific research topic. Documentary research process in research academic work helps to support the researchers referencing skills. The information used in documentary research can be either primary or secondary, and involves the use of external sources to defend the debate of a given research academic work. Payne (2004, pg. 222) defines the documentary research as a research technique used to group, explore, deduce and find out the weaknesses of physical sources, frequently written materials both in private and public sectors (Payne 2004, pg. 222). To achieve a good documentary research paper, there should be a clear structure of ideas relating to the to pic of study with the proper use of key words to ease the search. Documentary research comes prior to the literature review and hence, proper time management is a priority in carrying out this study. Literature review, on the other hand, usually comes after a research proposal and its deliverables. It involves the analysis of originally obtained information to review the acquired information and the significance of this information to the research topic. It achieves the purpose of updating the reader with the current reviews on a particular research topic and builds groundwork for future research studies in the same research area.Advertising Looking for assessment on education? Let's see if we can help you! Get your first paper with 15% OFF Learn More It also aids the researcher in highlighting areas of further research, which opens up the researcher’s scope for further studies (Grix 2000, pg 228). Literature review involves critique argument in that i t debates for or against the research topic. This argument helps to confirm or rule out arguments improving the entire quality of the study. It also highlights vital issues of past literature and how the literature relates with the current topic of study. The writing must involve the use of a logical flow of ideas, updated references relevant to the research topic and a consistent use of reference style. Conclusion In concluding, the fundamental requirement when writing either a documentary research or a literature review is the quality and relevance of the paper in connection to the research topic. These research approaches needs a keen consideration of research standards when carrying out a research on a particular research topic. It is necessary when carrying out research to be aware that, there are many unrecognized sources of information in the web. These unrecognized sources of information pose a great danger in both documentary research and literature review writing. The rele vance and value of these web documents must pass through a proper assessment before applying them in writing documentary research or literature review. The assessment can undergo four basic factors such as authenticity, material representativeness, paper credibility and meaning. References Grix, J. (2001). Demystifying Postgraduate Research, 3rd ed. Birmingham: University of Birmingham University Press Hart, C. (2001). A Comprehensive Guide for the Social Sciences, London: SageAdvertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Payne, G., Payne, J. (2004). Key Concepts in Social Research, London: Sage Publications Scott, J. (1990). A Matter of Record, Documentary Sources in Social Research, Cambridge: Polity Press

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was