Natural resistance mechanisms to HIV-1 infection Essay

Characteristic opposition instruments to HIV-1 disease - Essay Example There is presently no immunization or remedy for AIDS or HIV. The main realized technique is evading introduction of the infection. Anyway a treatment known as post-introduction prophylaxis is accepted to lessen the danger of contamination whenever started straightforwardly after presentation. Current treatment of HIV disease comprises of exceptionally dynamic enemy of retroviral treatment (HAART). This alludes to consolidated treatment with at least three medications, typically two that focus on the opposite transcriptase and one that objectives the viral protease. Kimball's science pages. 7 Oct. 2004. 24 Feb. 2007 Characteristic protection from HIV can be considered at two levels: protection from getting tainted with the infection and protection from the infection if the individual is as of now contaminated. The components of characteristic obstruction in the two cases are: Apoptosis. Apoptosis is a modified demise of the cells in multi-cells living being. During the HIV disease apoptosis is the fundamental component by which tainted and uninfected CD4+ lymphocytes are dispensed with. Anyway apoptosis as a characteristic safe instrument to HIV disease has not been investigated up until this point. Hereditary factor.

Seperation of Powers essays

Seperation of Powers papers The Judicial Branch in Regard to Separation of Powers The Doctrine of Separation of forces is that political force ought to be partitioned among a few bodies as a precautionary measure against oppression. The perfect is restricted the total power of the Crown, Parliament, or some other body. The outline for United States partition of forces is spread out in the U.S. Constitution and developed in the Federalist Papers. The balanced governance of the US government include the level division of forces among the official (the Presidency), the assembly (the two places of Congress themselves orchestrated to check and equalization each other), and the legal executive (the administrative courts). There is likewise a vertical detachment between the government and the states. Safeguards of detachment of forces demand that it is required against oppression, including the oppression of the larger part. Its rivals contend that sway must lie some place, and that it is better, and apparently increasingly majority rule, to guarantee that it generally e xists in a similar body. The United States needed to instate an administration organized so that each branch was isolated however equivalent. We will see, in any case, that it isn't generally a highly contrasting plan and that the legal branch has frequently wound up in the hazy area of power. The hypothetical thinking behind the requirement for partition of forces is spread out by Publius (Jefferson and Madison) essentially in Federalist Papers # 49 51. In American talk partition of forces is to a greater extent a name than an exact depiction. In application, none of the three branches is truly discrete from the others. This was the contention that James Madison tended to in The Federalist, no 47. The Anti-Federalist charge was that The few offices are mixed in such a way as without a moment's delay to pulverize all evenness and magnificence of structure, and to uncover a portion of the basic pieces of the building to the peril o... <!

Techniques for Idea Generation Mind Maps

Techniques for Idea Generation Mind Maps The Mind Mapping technique was created to be an effective way to produce ideas by association. It transforms a huge list of dull or tedious information into a highly organized, colorful and memorable pictorial representation that is in agreement with the brain’s normal manner of doing things. With respect to creative problem solving, mind maps help to show how different pieces of information or different ideas are connected. © Shutterstock.com | Petr VaclavekFrom this article, you’ll learn 1) definition of mind mapping, 2) how did this ideation technique originate? 3) essential features of a mind map, 4) how to build your own mind map, 5) applications of mind maps, 6) advantages of using mind maps, and 7) short note on mind mapping tools.DEFINITION OF MIND MAPPINGA mind map is a graphical representation utilized to visually organize information. The process of mind mapping involves penning a central theme and coming up with new and associated ideas that branch out from the central idea. The central single idea is frequently in the format of an image drawn in the middle of a blank landscape page to which connected representations of ideas such as words, images, facts, figures, concepts or parts of words are added as they are thought up. Mind mapping utilizes the concept of “radiant thinking.” This means thoughts radiate (branch out) in different directions from a single idea. The branches may move forwards and backwards to and from the main (central) idea. This is in contrast to “linear thinking” which is a thought process following a step-by-step flow or known cycles where it is necessary to get the response to one step before moving to the next step.As is the case with other mapping techniques, the objective of mind mapping is to concentrate attention and to acquire and frame knowledge to enable the sharing of concepts and ideas.HOW DID THIS IDEATION TECHNIQUE ORIGINATE?Tony Buzan is the name frequently used in connection with mind mapping. It is true that he popularized the term “mind map.” However, the utilization of diagrams that graphically “map” information using radial maps and branching, dates back centuries. Similar strategies were utilized in the 3rd century by Porphyry of Tyros to conceptualize Aristotle’s ideas.The semantic network was created in the late 1950s as a hypothesis to comprehend human learning that was further revised by M. Ross Quillian and Allan M. Collins at some point in the early 1960s. The radial structure of mind maps is similar to that of concept maps, created in the 1970s by learning specialists. However, the difference is that the former are made easier by concentrating around a central, single key concept.Tony Buzan’s argument is that ‘traditional’ outlines call for the reader to scan information in a left to right, top to bottom manner that is in contrast to the brain’s natural propensity to scan the whole page in a non-linear manner. Buzan additionally utilizes widespread suppositions pertaining to the cerebral hemispheres so as to encourage the exclusive utilization of mind mapping in preference to other kinds of note making.ESSENTIAL FEATURES OF A MIND MAPGiven below are five key characteristics of a mind map:There is a single key idea, focus, subject or concept graphically represented in the form of a central image.The key themes associated with the idea, focus, subject or concept radiate fr om the central picture as branches.Each branch carries a key word or image printed or drawn on the associated line.Other branches, shown as twigs are connected to the main branches. The twigs represent concepts of lesser importance.The branches create a linked nodal structure.HOW TO BUILD YOUR OWN MIND MAPIf you are using a mind map to get employees in your business to come up with ideas/solutions, you may give them instructions as follows:Prerequisite: Keep blank paper and colored pens ready. If A4 paper seems inadequate, you can consider A3 paper.Step 1: Start with the topic Put the topic, central concept or idea in image form, in the center of an empty page. Space on the page should be used wisely and yet freely so that the brain doesn’t feel unbridled, and there is space to occupy more and more ideas as they come. Beginning in the center provides the brain with freedom to move in all directions and reveal ideas/solutions more naturally and freely. It may be more convenient to position the page in landscape orientation because that makes drawing easier.Step 2: Define the structure Create the fundamental structure with which you would be organizing your ideas. The structure would include branches radiating out from the central idea and drawn as thick lines. These main branches are termed as Basic Organizing Ideas (BOIs).Step 3: Define each branch Put down a key image or word for each branch as your ideas come. Allow the ideas to flow freely and quickly (long pauses are not to be encouraged) without judgment on whether they are practical or crazy. Also no need to bother about aesthetics. Draw freely and unconcernedly.Step 4: Highlight the priorities The concepts of lesser importance can be represented as the twigs and drawn as thinner lines.Step 5: Extend your mind map by additional ideas As information and ideas keep coming, connect them to the mind map in a suitable manner.Step 6: Review and revise After the first attempt, allow your mind to settle. Once it has, you may want to revisit what you did. Review it and revise and/or reorder it. Sometimes, a different sheet of paper may be required for this.How about two mind maps?Another way to mind map and this is for problem-solving, is to create two different mind maps, one each for the problem and solutions. For the problem mind map, the problem would be the main idea represented in the center with causes and aspects of the problem connected by branches. Sub-branches can be used to examine the problem in more detail. For the solution mind map, the solution would be the key idea represented in the center. By way of the main branches, one can provide the routes that would help to solve the problem. One can incorporate organizations, colleagues, resources or techniques that would be of assistance and associated with those routes. Sub-branches can be added as one venture into the details.Drawing two mind maps makes one realize that a single obstacle could have multiple potential solutions . It is up to the person drawing the mind map and others concerned to find that solution(s) which is most practical, cost-effective and/or time-saving. A final branch may be developed with the selected solution or blend of solutions, with the sub-branches connecting to and from the details of intended method(s) of implementation.A properly done mind map is very easy to review as it is possible to frequently refresh information mentally just by a cursory glance. The mind map would depict the “shape” of the topic, the comparative significance of individual branches/twigs, and the manner in which facts are connected to one another. Remembering the structure and shape of the mind map can provide cues that would help to recollect the information within the map.Suggestions/Tips/TechniquesUse colors for the whole project. Colors give the mind map extra vitality and arouse the brain’s creative and visual faculties.Stick to single words or brief meaningful phrases for key words. Too ma ny words would only cause cluttering.Similar information, if any, can be clustered together.Capital letters are to be preferred to small caps.It would be a good idea to make the branches curved instead of straight. Only straight lines in the map may come across as boring to the brain.Use as many images as possible. Besides being easy to remember, a picture is worth a thousand words.Use arrows to show connections between ideas.If the person wishes and if required, he can annotate the mind map. An example would be providing references to other sources, making them identifiable by writing them down in a different color of pen.One should feel free to adopt a personal style as this would boost the creative fire.Information in one section of the mind map may have some connection to another section. If this is the case, the person can draw lines to depict the cross-linkages. This would assist with comprehending how one aspect of the subject impacts another. It is also acceptable to use oth er visuals such as callouts or speech bubbles to depict the link to the key/central idea or theme.The person should stay calm throughout the mind mapping process. This suggestion may not be suitable for an office environment but is good for mind mapping at home. To do so, the person should distance himself from the topic to work on, by taking brief breaks and then coming back to it clearheaded and fresh. A short walk could help. By providing the brain with rest, one will find that it becomes more forthcoming with ideas.APPLICATIONS OF MIND MAPSAs is the case with other diagramming tools, this idea generation technique may be utilized to generalize, structure, visualize and classify ideas. It also helps with triggering creativity and creative solutions, organizing information, making decisions and solving problems. Mind mapping is also used for brainstorming. Here, ideas are introduced into the map in a radial manner surrounding the central node, bereft of the implicit prioritization associated with sequential or hierarchy arrangements, and in which grouping and organizing is kept for later stages.Data collected from mind maps may be utilized to enhance various other applications, examples being search engines and specialist search systems. To achieve this, the mind map may be examined with traditional techniques of information recovery to classify the author of the mind map or documents that are connected from inside the mind map.Other applications include:Making notes, whether for presentations or essays, from lectures or from secondary sources such as books;Studying and remembering information (it has been propounded that mind mapping can enhance study/learning effectiveness by 15 percent more than traditional note-taking;Displaying information in a layout that depicts the structure of a subject taken as a whole;Simplifying a complicated idea;As a mnemonic;To team up in sessions of color pen creativity.ADVANTAGES OF USING MIND MAPSMind maps help the user uti lize the complete power of the brain, both the left which is more associated with logical and analytical thinking, and the right which is utilized for day dreaming, spatial awareness, color, imagination and a feeling of wholeness. This idea generation technique has several advantages including that it:Spurs one on to view the bigger picture;Requires less time to develop;Consumes less space than notes that are chronologically arranged;Allows large topics or projects to be broken down into manageable chunks and this broken-down form, therefore, facilitates effective planning and minimizes chances of forgetting key points and being overwhelmed;Increases concentration;Helps trigger more associations and ideas by applying radial thinking;Provides pleasure to the eyes (once completed, the mind map appears like a mini work of art to those who behold it).SHORT NOTE ON MIND MAPPING TOOLSThough in many cases, it is suitable to draw mind maps using the hand, software applications and tools can broaden the scope of mind-mapping by permitting those engaged in the process to map more than ideas and thoughts using information on the internet and computers, such as documents, spreadsheets, images and internet sites. A few of these tools are discussed below:iMindMap: This concept mapping software utilizes Tony Buzan’s trademark mind mapping techniques to develop maps for project management, brainstorming, creative thinking, organizing, and planning and delivery of presentations. ThinkBuzan developed the desktop application. The tool runs on Mac OS X and Microsoft Windows. iMindMap has focus applications, examples of which are Expand and Collapse Branches and Focus In and Out which can assist with moving around the problem and making the mind concentrate.Coggle: This is a freeware web application for mind mapping. Some of its prominent features are real-time collaboration, markdown text formatting, iOS support, sharing with individuals, organizations or through a private link , and LaTeX math support utilizing  MathJax. Auto-save and revision features mean it is possible to view how the mind map looked prior to someone who was invited beginning to work with it. The software enables creation of linear and organic mind maps utilizing a keyboard, mouse, tablet computer or interactive keyboard.XMind: Created by XMind Lt.d, XMind software helps with both mind mapping and brainstorming. Apart from the management elements, the tool can clarify thinking, capture ideas, promote team collaboration and handle complicated information for greater productivity. In addition to mind maps, it supports spread sheets, fishbone diagrams, organization charts and tree diagrams.Mind maps are currently utilized by many millions of people across the globe. It appears that this idea generation technique will increase in popularity and continue to be used for many, many years to come.

Enterprise and Innovation Free Essay Example, 3000 words

In other words, they are concerned with economic development of the country. Thus, in order to improve business practices, entrepreneurs can be exploited to bring in new and innovative ideas to increase profitability margins for the company (Kuratko 2013). A company can increase its share value by either focusing on profitability by monetary gain and also by focusing on non-monetary worth i. e. building and sustaining Goodwill to enhance its business activities (Trehan and Treha 2009 p. 196). Focus on building and sustaining Goodwill In order to increase market share, entrepreneurs shall be encouraged to focus on building the Goodwill for the company. This can be carried out by focusing on training entrepreneurs in customer service and sales department. In this regard, it is vital to state the goodwill can only be established if the company provides excellent goods and services to its customers, where the staff is polite and courteous, and there is quick, convenient delivery of their products. These traits shall help the organization become a recognized brand name, and its goodwill shall increase (Tremblay and Tremblay 2012, p. 394). Entrepreneurs need to be devoted to the company, to stay active, polite in order to build goodwill. We will write a custom essay sample on Enterprise and Innovation or any topic specifically for you Only $17.96 $11.86/pageorder now Focus on sales and profitability In order to gain sales and increase profitability, the company needs to focus on developing a productive workforce that works with innovation in marketing and sales department to promote the products of the company. In this regard, the entrepreneurs need to be encouraged by the management to work with devotion (Birn, 2004 p. 185). The following steps can be taken by the management to encourage entrepreneurship to enhance profitability, increase sales and gain market share. Ways to encourage Entrepreneurship Focusing on Organizational culture Entrepreneurship can be encouraged if they are given an effective working environment where they are inspired to work with devotion and commitment. A good corporate culture would not just make the environment relaxing but encourage creativity, and cultivate the mind towards developmental opportunities which are very essential for personal and professional growth (Davila et al. 2007). Employee Engagement In order to encourage entrepreneurs, the company shall install effective engagement processes where key employees would be required to communicate and give their opinions about various decisions taking place in the organization. This engagement process shall help young entrepreneurs explore themselves and communicate ideas for learning opportunities.

Exploring Aspects of the Alzheimer’s Disease Essay

Over four million Americans have been diagnosed with Alzheimer’s disease (1). One of those is my grandfather. He has suffered from Alzheimer’s for almost 8 years. I have watched my grandfather slowly decline and forget things such as where he lived, my name, and even how to talk. Many times I was upset and confused and often puzzled at the way he acted. I knew something was seriously wrong because he could never remember anything and often had tears in his eyes. I felt angry when he didn’t remember who I was. Eventually, he could no longer put together a sentence that made sense and he relied on others for total care. We have been forced to place him in a nursing home, and watch him†¦show more content†¦When he dissected her brain, he discovered coiled deposits around the nerve cells, called neuritic plaques. He also discovered twisted bands of fibers, or neurofibrillary tangles, inside the nerve cell in the brain. However, even after this disc overy, the disease still wasn’t recognized as a major disease until 1970, when neurological research began to expand. This degenerative brain disorder has since, been named after Dr. Alzheimer. Even today, doctors use the same technique that Dr. Alzheimer used to observe the plaques and tangles in the brain. (2) Studies show that the risk of developing Alzheimer’s disease increases with age. Almost 20 percent of Americans between the years of 75 and 84, and almost half of those that are 85 years and older suffer from Alzheimer’s disease (3). One out of every 10 persons that are 65 years of age and older are said to be victims of Alzheimer’s disease, yet even some early-onset victims might be in their 40s and 50s (4). Many believe that if an individual develops Alzheimer’s at an early age, it is related to genetics. Yet, still others believe that Alzheimer’s that develops at a later age, is related to genetics as well. A mutation on chromosome 19 has been linked with a later onset of Alzheimer’s disease, but not everyone that has the mutation develops the disease (5). Therefore, the parallelShow MoreRelatedThe Human Of Human Genome Project995 Words   |  4 Pagesfor diseases. It guided the medical field to new direction but at the same time created new challenges and problems. The primary objective of the project isn’t wrong or questionable but some believe its implications are. Genes are made of a molecule called DNA (deoxyribonucleic acid) which contains the instructions for making every protein in the body. By studying and understanding the genome system completely, we will be able to shed some light on how to diagnose and treat chronic diseases at anRead Mor e Anosmia Essay1649 Words   |  7 Pages(Toller, 1999). On the other hand, some people will constantly eat trying to satisfy their need for taste and put on an excess of unhealthy weight. Another issue to consider when discussing anosmia is safety. Probably one of the most important safety aspects of all people is the ability to smell fire. Anosmics may be in greater danger with these situations. They should be encouraged to check the batteries in their smoke detectors often, and consider having their natural gas checked by a professional monthlyRead MoreMy Hero In My Life720 Words   |  3 Pagesextended into all aspects of my life beginning with my family’s deep medical history. Throughout my life, I have seen the walls of a hospital one too many times for a series of family medical emergencies. My first experience was when my father suffered a sudden heart attack. I remember being very young but in a state of confusion mixed with the fear of losing him. I kept think ing about how this could have happened and what could have been done to prevent this. With heart disease, came a mandatoryRead MoreAn Overview of Alzheimers Disease and Dementia Essay1938 Words   |  8 PagesAlzheimer’s Disease Dementia Intro/Overview Section of Disease Paper â€Å"Horribly tragic, scary, slow, sad, maddening, etc.† These are words some would use when asked what Alzheimer’s/dementia is. This answer is common to those who have watched loved ones suffer from this disease that ultimately lead to their passing. As defined in McGraw Hill Medical Dictionary, Alzheimer’s Disease is a ‘progressive neurologic disease of the brain that causes irreversible loss of neurons and eventualRead MoreInformative Essay About Dance Therapy1515 Words   |  7 Pagesthe second group consisted of people who suffered from genetic diseases and severe psychomotor retardation, and the third group was the elderly. The first group (ages 26+) were patients who suffered from intellectual disabilities like motor disorder as a consequence of cerebral palsy, speech impairment, auditory function, and difficulties with motor skills. The second group (ages 26-50) had individuals who suffered from a genetic disease and severe psychomotor retardatio n. The third group was olderRead MoreSymptoms And Symptoms Of Alzheimer s Disease2317 Words   |  10 Pagesis an inevitable process that every human being goes through. It is very important to see how people change as they age and the various experiences they go through. One of the most common diseases among older people is dementia. Among the different types of dementia, the most prevalent one is Alzheimer’s disease (AD). It is important to look at all of the signs and symptoms of each type of dementia to see which specific type best describes a person’s condition. There is one patient in particular,Read MoreThe Ethics of Cloning Essay1504 Words   |  7 Pagesthis paper the reasoning behind why cloning is an acceptable and potentially life changing science will be examined. Along with this we will take a close look at the arguments against cloning and exploring the flaws within the argument. This will affirm that cloning is useful because it cures diseases, pass es on genes, and repopulates endangered species. In order to have a legitimate argument for the reasoning why cloning is or is not acceptable it is important first to be understand what exactlyRead MoreGenetic Testing And Mental Health Disorders1039 Words   |  5 PagesHuntington’s disease through human genome and family research. Diagnostic and presymptomatic testing is available by discovering a gene mutation for Huntington Disease (HD) and prepares persons who are at risk for Huntington Disease (HD) to ask for genetic testing. A multi-visit protocol is enacted when HD genetic testing is offered through HD testing centers, followed by education and counseling for those requesting to have HD gene testing. I will use this paper to define Huntington’s disease, choreaRead MoreAlzheimers Disease Essay1677 Words   |  7 PagesTITLE ABSTRACT Alzheimer’s Disease (AD) has been implicated with two major pathologies, the accumulation of amyloid-B and tau phosphorylation (_). These pathologies have long been implicated with the gene Alipoprotein E (ApoE) which continually showed a dosage-dependent effect on amyloid-B clearance (_). Many studies have shown correlated linkage between ApoE and tau as well as their possible interactions (_). Tau phosphorylation has continually been found among many AD patients sufferingRead MoreThe American Heart Association Scientific Advisory2236 Words   |  9 Pagesbyproduct of protein metabolism, which damages the epithelium and increases the risks of cognitive decline (Sears 51). Likewise, a 2012 meta-analysis of seven randomized control trials (RCTs) estimated that a ten percent reduction in coronary heart disease was linked to each five percent energy increase in PUFA consumption (â€Å"Essential†). Furthermore, results of cell culture and animal studies suggest that n-3 fatty acids can modulate the expression of genes, including those involved with fatty acid

Skema Answer Manufacturing Proces 1 Free Essays

FACULTI OF MECHANICAL ENGINEERING UNIVERSITI MALAYSIA PAHANG BMM3643 (SEM II_2012-13) Assignment #1 1. a) What metals are frequently cast into products? b) What materials are used to produce the expendable patterns for investment casting? c) Explain why a casting may have to be subjected to various heat treatments. (8 marks) Answer a) Cast parts can range in size from a fraction of an inch and a fraction of an ounce to over 30 feet and many tons. We will write a custom essay sample on Skema Answer Manufacturing Proces 1 or any similar topic only for you Order Now Moreover, casting can incorporate complex shapes, hollow sections or internal cavities, and irregular curved surfaces. b) In investment casting a pattern is formed from a low melting temperature, low vaporization temperature material, often wax. The mold is produced by surrounding the pattern with the mold material. The mold cavity is produced when the pattern is removed by melting/vaporizing the pattern. In early process development with porous mold materials the melted wax from the pattern would migrate into the mold material and be lost. ) Heat treatments (described in Chapter 4) such as quenching and tempering, among others, are carried out to optimize the grain structure of metal castings, thereby controlling and enhancing mechanical properties. Heat treating can control microporosity, which is a main reason that castings are weak in tension. 2. a) What are some of the attractive features of die casting compared to alternative casting methods? b) For the cast metal wheel illustr ated in Figure below, show how (a) riser placement, (b) core placement, and (c) chills may be used to help feed molten metal and eliminate porosity in the isolated hub boss. ) What are some of the general defects encountered in casting processes? Name and briefly describe three. (8 marks) Answer a) Die casting is characterized by extremely smooth surface finishes, excellent dimensional accuracy, and high production rates. A single set of dies can produce many thousand castings without significant changes in dimension. b) Solutions; i) Riser ii) Core iii) Chills c) General defects include; v) misruns, in which the casting solidifies before filling the mold cavity v) cold shuts, in which two portions of metal flow together but there is lack of fusion at the joint; vi) cold shots, where solid globules of cast metal become entrapped in the casting; vii) shrinkage cavity, which is a depression on the casting surface or an internal void in the casting caused by solidification shrinkage; v iii) microporosity, which is a network of small voids throughout the casting caused by localized solidification shrinkage; and ix) hot tearing, which is a crack in the casting caused by a mold that does not ield to the metal during the early stages of solidification shrinkage. 3. a) How does the fabrication of a thermoplastic polymer differ from the processing of a thermosetting polymer? b) What are the significant differences in the equipment and operating procedures between injection mold- ing of thermoplastics and injection molding of thermosets? c) Can thermosetting plastics be used in injection molding? Explain. (8 marks) Answer a) Thermoplastic polymers can be heated to a temperature at or near the melting temperature so that the material becomes either a formable solid or a liquid. The polymer can than be cast, injected into a mold, or forced through a die to produce the desired shape. With thermosetting polymers, once the polymerization has occurred, no further deformation can occur. Thus, the polymerization reaction and the shape-forming process must be accomplished simultaneously. b) The differences in injection molding of thermosets are (1) shorter barrel length, (2) lower temperatures in the barrel, these first two reasons to prevent premature curing; and (3) use of a heated mold to cause cross-linking of the TS polymer. c) Thermosetting plastics are suitable for injection molding. The basic modification which must be made to the process is that the molds must be heated to allow polymerization and crosslinking to occur in the mold cavity. The major drawback associated with this change is that, because of the longer cycle times, the process will not have as high a production rate as injection molding of thermoplastics. 4. a) Identify one injection molding process could be used to inject a single part with two or more different material as shown below. b) Describe process mechanism c) List and explain THREE (3) advantages of this technology? (8 marks) Answer a) Multi-shot injection molding ) This process ables to to shoot two or more different materials into the same mold, into different locations, resulting in parts with increased functionality, improved cosmetics, and multiple mechanical properties. c) Advantages; i) Reduced cycle time * Compared to multiple molding cycles of separate components, molding multiple materials in the same cycle has obvious time and labor benefits. ii) Reduced part cost * Combine reduced cycle times, reduced labor times, and eliminated assembly operations, and the total cost of multi-shot molded parts becomes less, compared to alternative single-shot methods. ii) Improved Adhesion * With multi-shot molding we get a true physical bond, resulting in a much stronger, longer lasting bond, compared to more traditional â€Å"skin on skin† insert molding or post-molding assembly. 5. d) What are sheet-molding compounds (SMCs)? Bulk-molding compounds (BMCs)? e) What are some of the forms in which reinforcement fibers appear in composite materials? f) Describe the problems involved in recycling products made from reinforced plastics. (8 marks) Answer a) Sheet molding compounds are sheets composed of chopped fibers and resin, the sheets being about 0. inch in thickness. These can be press-formed in heated dies to provide an alternative to sheet metal where light weight, corrosion resistance and integral color are desired. Bulk-molding compounds are fiber-reinforced thermoset molding materials containing short fibers in random orientation. They are formed into products using processes like compression molding, transfer molding or injection molding. b) Fiber-reinforced composites use the strength of the fibers to impart additional strength to the fiber-matrix whole. The use of fibers means that added strength will be in the fiber length direction. The commonly used fiber forms are; i) long, continuous fibers are their use results in increased strength in the fiber length direction, ii) fibers woven into fabric layers used in thin sheet composites and they add strength in the two in-plane fiber directions, iii) woven fabrics of fibers formed in three dimensions so that when embedded in the matrix strength in three dimensions is increased, iv) short, chopped fibers that can be oriented in a particular direction or randomly. ) The main problems are that recycling usually requires the use of a single type of material, and that some plastics (mainly hard and brittle polymers) are more difficult to chop into small pieces for further processing than others. With reinforced plastics, this requires that the reinforcement be separated from the matrix, a very difficult task and uneconomical task. Note that matrices are often thermosets, so it is not practi cal to melt the matrix and separate the fibers from a molten phase. 6. ) In the casting of steel under certain mold conditions, the mold constant in Chvorinov’s Rule is known to be 4. 0 min/cm2, based on previous experience. The casting is a flat plate whose length =30cm, width =10cm, and thickness =20 mm. Determine how long it will take for the casting to solidify. h) A round bar of 15-mm diameter is extruded from a single-screw extruder of 100 mm barrel diameter. The material is LDPE. Calculate; i) The approximate flow rate (kg/h), ii) Speed of emerging extrusion Given : Density LDPE = 0. 92 g/cm3) (10 marks) Answer a) Volume V = 30 x 10 x 2 = 600 cm3 Area A = 2(30 x 10 + 30 x 2 + 10 x 2) = 760 cm2 Chvorinov’s Rule: TTS = Cm (V/A)2 = 4(600/760)2 = 2. 493 min b) R i) Flow rate, qe= CeDscr = 0. 006(100)2. 3 = 238. 86 kg/h ii) Density, ? = 0. 92 g/cm3 Cross-sectional area = (152*? )/4 = 1. 767cm2 Volume = 238. 86 / 0. 92 = 259635cm3/h = 72. 12cm3/s Extrusion speed = 72. 12 / 1. 767 = 40. 8 cm/s ****************************************************** How to cite Skema Answer Manufacturing Proces 1, Papers

Pro Capital Punishment Essay Example For Students

Pro Capital Punishment Essay What is capital punishment? Capital punishment is the maximum penalty of aconviction. More than 4, 400 people have been executed since 1930. There is noway of knowing how many people have been executed in U.S. history because theyused to be local affairs with nobody to record them. On the edge of the 21stcentury, Capital punishment is still one of the two most debated issues in theU.S., the other is abortion. This paper will attempt to show the effects ofcapital punishment and how it is used. Capital punishment has been a veryattention grabbing incident over the years. For example, in 1936, about 20,000people gathered in Owensboro, Kentucky, on the morning of August 14 to see thehanging of a 22 year old black man, Rainey Bethea. Many people have also diedwrongfully. Sacco and Vangetti were two Italian immigrants that were accused ofpayroll robbery. Although they had alibis of there whereabouts, they were stillconvicted of the crime and sentenced to death by the electric chair. Nearly every culture throughout history has practiced capital punishment. Quarteringwas a popular method in Europe. Quartering is being torn apart by horses. InIndia, executions were sometimes carried out by having an elephant crush thecondemneds head. In modern times, societies have sought to make executionsmore humane. Such was the goal of the guillotine, which severed thecondemneds head with a heavy blade, and the electric chair which kills with amassive dose of electrical current. The Constitution of the United Statesguarantees to every citizen certain fundamental rights. The First Amendment, forexample guarantees freedom of religion, speech, press, assembly, and petition. The Second Amendment promises that the right of the people to keep and beararms shall not be infringed. The amendment most relevant to the issue of thedeath penalty is the Eighth Amendment. It reads: Excessive bail shall not berequired, nor excessive fines imposed, nor cruel and unusual punishmentinflicted. However simple and straightforward these words may sound, its notalways clear what they mean. That is because the words cruel and unusual aresubjective. One person may think, for instance, that capital punishment is crueland unusual, while another person may not. In 1972, the Supreme Court declaredthe death penalty cruel and unusual, and therefore unconstitutional. It was soonreactivated in 1976 by 35 states. People have tried to influence decisions onthe death penalty. For example, the Pope has played a role in the decision ofthe death penalty. The Pope pleaded for a criminals life and the criminal wassentenced to life in jail instead of the electric chair. Many people that arein nocent have been sentenced to death. Harry Blackman, a death penalty opponent,stated Innocent persons have been executed and will continue to beexecuted, explaining why he could no longer support the death penalty. Isidore Zimmerman, came within 2 hours of execution for a murder he did notcommit. Citing instances like this, death penalty opponents claim that thedanger of a terrible and irrevocable mistake capital punishment intolerable. Cost often comes up when the death penalty is mentioned. Those in favor of thedeath penalty say the government shouldnt waste its money on guarding,feeding, and housing a depraved criminal for the rest of his or her life. Thetruth is, however, that it costs much more to put a prisoner to death than tokeep a prisoner in jail. It cost about 2 million to 3 million dollars tosentence someone to death and keep them on death row for 8 years. The same itcosts to keep 3 prisoners in a maximum security prison for 40 years. Opponentsuse this as a contradiction. Race is a big issue in death sentencing althoughnot admitted. There is still a lot of hard decision making when it comes toethnics being punished. A comprehensive examination of capital murder casesin Georgia, a black convicted of murdering a white has a 22 percent chance ofbeing sentenced to die, whereas a white convicted of murdering a black has onlya 3 percent chance. This has been a big thing in the civil issues in America. .u8c66ebbfe2ebcf68b6d14745d1b068f7 , .u8c66ebbfe2ebcf68b6d14745d1b068f7 .postImageUrl , .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text-area { min-height: 80px; position: relative; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 , .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover , .u8c66ebbfe2ebcf68b6d14745d1b068f7:visited , .u8c66ebbfe2ebcf68b6d14745d1b068f7:active { border:0!important; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .clearfix:after { content: ""; display: table; clear: both; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:active , .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text-area { width: 100%; position: relative ; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:hover .ctaButton { background-color: #34495E!important; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u8c66ebbfe2ebcf68b6d14745d1b068f7 .u8c66ebbfe2ebcf68b6d14745d1b068f7-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u8c66ebbfe2ebcf68b6d14745d1b068f7:after { content: ""; display: block; clear: both; } READ: Juveniles And The Death Penalty (1498 words) EssayWhen the death penalty is actually brought out to the society, basicallyeverything has an a effect on it. Religion, race, cost, and morals, but it isstill used in America today. Many democratic countries have outlawed the deathpenalty and the U. S. probably should too. The Pope of the Catholic Church oncesaid, Only God has the Power to give and take life from someone. Thisbeing true to most people, but the government and the American society have todecide whether or not to keep capital punishment.

Foreign Debt Crisis Management free essay sample

The topic of assignment is to study the debt crisis management and impact of un-hedged exposure aspects of RCom – a major Telecom Service provider in India. RCom has entered in high-debt levels i. e Rs 35000 crore and it has been further compounded because of the steep depreciation of the rupee, where nearly three-fourths of Loan is in foreign currency. RCom has implemented refinancing strategy for the loan outstanding by Industrial and Commercial Bank of China (ICBC), China Development Bank (CDB), Export Import Bank of China (EXIM), and other banks. This strategy will be benefited from extended loan maturity of seven years and attractive interest cost of about 5 per cent and the loan would be used for refinancing the entire redemption amount of FCCB. In this assignment, I have studied the financial crisis management part which is managed by the company with some strategic move of loan refinancing and a smart move of fund raising through listing of Flag telecommunication at Singapore and set an indicative price range for the Singapore initial public offering of its undersea cable unit (Flag Telecommunication) that could raise as much as $1 billion and help to reduce its debt load. We will write a custom essay sample on Foreign Debt Crisis Management or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page I have also studied the impact of heavy debt on companys financial credit worthiness and impact of rupee devaluation on overseas loan taken from China and loss incurred due to huge exposure of un-hedged transactions. Reliance Communications Limited is the flagship Company of Reliance Group, one of the leading business houses in India. Reliance Communications is India’s foremost and truly integrated telecommunications service provider. The Company, with a customer base of 152 million as on March 31, 2012 including over 2. million individual overseas retail customers, ranks among the Top 4 Telecom companies in the world by number of customers in a single country. Reliance Communications corporate clientele includes over 35,000 Indian and multinational corporations including small and medium enterprises and over 800 global, regional and domestic carriers. Reliance Communications has established a pan-India, next generation, integrated (wireless and wire line), convergent (voice, data and video) digital network that is capable of supporting best-of-class services spanning the entire communications value chain, covering over 24,000 towns and 600,000 villages. Reliance Communications owns and operates the world’s largest next generation IP enabled connectivity infrastructure, comprising over 277000 kilometers of fiber optic cable systems in India, USA, Europe, Middle East and the Asia Pacific region. Assignment analysis and study RCom has entered in high-debt levels i. e Rs 35000 crore because of high capital investment for changes in industry landscape, rapid emergence of newer business opportunities like 3G, mobile broadband data, etc, and evolving regulatory framework. RCom continues to actively evaluate and execute the most relevant organization structure to address the market opportunity. In the 2 years, RCOM has taken several measures to reduce its mounting debts. 1. Reliance Communications has secured loans from a host of Chinese banks to refinance $1. 18 billion worth of outstanding foreign currency bonds due for redemption. The deal has provided RCOM a major support, where company is trying for more than a year to sell its telecoms tower unit to cut the companys about $6. 5 billion debt. Reliance Communications said Industrial and Commercial Bank of China, China Development Bank Corp, Export Import Bank of China and other banks were funding the refinancing of the outstanding foreign currency convertible bonds (FCCBs). The company said it would benefit from extended loan maturity of seven years and attractive interest cost of about 5 percent, sending its shares up as much as 5. 7 percent in a Mumbai market that rose 1. 5 percent. The FCCBs were issued in February 2007 when the Indian markets were booming, with a conversion price of 654 rupees a share. Cut-throat competition among Indias mobile phone operators has since hit earnings and shares have plunged. Reliance Communications shares were trading around 90 rupees, a fraction of the conversion price. Reliance Communications has talked with China Development Bank for a syndicated loan to redeem the bond. China Development Bank arranged loans worth $1. 93 billion for Reliance Communications, which the company used to finance radio airwaves it acquired during a costly 3G auction, as well as for the purchase of equipment. With its bruising debt load and a ferociously competitive 15-operator arket, Reliance Communications has reported eight straight quarters of falling profits. Reliance communications has tried once again and talked with U. S. buyout giants Carlyle Group and Blackstone Group on a deal for the towers business which could be worth more than $3 billion, but unfortunately the deal is not closed to completion. 2. RCom has filed a prospectus with the Singapore Stock Exchan ge and plans to divest as much as 75% stake in Flag Telecom to raise about $1 Billion- Reliance Communications was looking to secure a leasing agreement for its towers from Reliance Industries, before pressing forward with a tower sale. It has also not settled. The efforts to sell a majority stake in Reliance Infratel are still to fructify, in the mean time company has decided the listing of Reliance Globalcom. , where the Reliance Globalcom can help the company to raise Rs 50 billion-Rs 65 billion by divesting 75 per cent stake in its submarine cable business. The issue has opened at a price range of $1. 09-$1. 32 per unit. The bankers for the issue include Deutsche Bank, DBS of Singapore, Standard Chartered and the Industrial and Commercial Bank of China. Reliance Globalcom will be listed under the business trust structure. Post the listing, the company’s submarine assets and business will continue to be controlled by the existing management. RCOM will continue to hold the remaining 25 per cent equity stake. A. Background of Reliance Globacom Reliance Globalcom was formed in 2003 as a result of an amalgamation of Flag Telecom with the Reliance Group for $207 million. Flag, which had emerged from bankruptcy proceedings and had been on the block for over a year before being acquired by Reliance, was reeling under losses. However, the acquisition gave Reliance a foothold in the global business arena with over 50,000 km of submarine cables, thereby ending Tata Communications’ monopoly in the undersea cable field. From 2005, Flag embarked on an expansion path and finally broke even in September 2006. It introduced several higher-value-added products, including international private leased circuits (IPLCs), virtual private networks (VPNs) and Ethernet services. This accelerated the company’s revenue growth and increased its profitability. Flag Telecom later came into the fold of RCOM, led by Anil Ambani, after the Reliance Group’s businesses were split between the brothers, Mukesh and Anil Ambani. In 2008, the company was integrated into RCOM’s international operations under the Reliance Globalcom brand. B. Cable network of Flag Telecom Reliance Globalcom owns the largest private cable network in the world with over 277,000 route km of fibre optic cables. This includes 68,000 km of subsea fibre. Through strategic relationships with over 750 network service providers across the world, Reliance Globalcom provides assured connectivity to 163 territories worldwide. This makes RCOM a carrier’s carrier as it provides global connectivity solutions to carriers and internet communities through its submarine cable system. The company has cable landing tie-ups across 46 locations in 26 countries with 31 partners. The company’s global backbone spans four continents, connecting key business markets in Asia, Europe, the Middle East and the US. The network consists of five cable systems – FLAG Europe Asia (FEA), FLAG North Asian Loop (FNAL), FLAG Atlantic 1 (FA-1), FLAG Alcatel-Lucent Optical Network (FALCON) and HAWK. The company also owns and operates a low latency, global MPLS-based IP network, which connects most of the world’s principal international internet exchanges. FNAL represents a part of the 9,800 km North Asian Loop submarine, an intra-Asia submarine cable system that links Japan, Korea, Taiwan and Hong Kong in a ring configuration. The entire FNAL submarine cable system consists of six pairs of fibre, three of which are owned by Reliance Globalcom.

Documentary Research

Documentary Research Introduction Documentary research is a type of academic research that employs the use of source materials such as documents and texts for studying a specific research topic. Source materials used in this form of research may include newspapers, census results, story books, government publications, diaries, videos, works of art certificates visual and photographic items done on paper and so on.Advertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Documentary research is the most commonly used type of research document amongst the three major social research methods (Scott 1990). Literature review on the other hand refers to a given body of secondary text of an existing document. These documents can either be published or unpublished documents meant to review important points of knowledge needed to carry out comprehensive findings to a given research topic. It gives an general idea of both theory and methodology of a specific research topic (Hart 2001). Discussion Documentary research process employs the use of conceptualizing methods in document review and use. It involves the use of ether qualitative or quantitative research analysis skills, or it may sometimes employ the use of both techniques to study a specific research topic. Documentary research process in research academic work helps to support the researchers referencing skills. The information used in documentary research can be either primary or secondary, and involves the use of external sources to defend the debate of a given research academic work. Payne (2004, pg. 222) defines the documentary research as a research technique used to group, explore, deduce and find out the weaknesses of physical sources, frequently written materials both in private and public sectors (Payne 2004, pg. 222). To achieve a good documentary research paper, there should be a clear structure of ideas relating to the to pic of study with the proper use of key words to ease the search. Documentary research comes prior to the literature review and hence, proper time management is a priority in carrying out this study. Literature review, on the other hand, usually comes after a research proposal and its deliverables. It involves the analysis of originally obtained information to review the acquired information and the significance of this information to the research topic. It achieves the purpose of updating the reader with the current reviews on a particular research topic and builds groundwork for future research studies in the same research area.Advertising Looking for assessment on education? Let's see if we can help you! Get your first paper with 15% OFF Learn More It also aids the researcher in highlighting areas of further research, which opens up the researcher’s scope for further studies (Grix 2000, pg 228). Literature review involves critique argument in that i t debates for or against the research topic. This argument helps to confirm or rule out arguments improving the entire quality of the study. It also highlights vital issues of past literature and how the literature relates with the current topic of study. The writing must involve the use of a logical flow of ideas, updated references relevant to the research topic and a consistent use of reference style. Conclusion In concluding, the fundamental requirement when writing either a documentary research or a literature review is the quality and relevance of the paper in connection to the research topic. These research approaches needs a keen consideration of research standards when carrying out a research on a particular research topic. It is necessary when carrying out research to be aware that, there are many unrecognized sources of information in the web. These unrecognized sources of information pose a great danger in both documentary research and literature review writing. The rele vance and value of these web documents must pass through a proper assessment before applying them in writing documentary research or literature review. The assessment can undergo four basic factors such as authenticity, material representativeness, paper credibility and meaning. References Grix, J. (2001). Demystifying Postgraduate Research, 3rd ed. Birmingham: University of Birmingham University Press Hart, C. (2001). A Comprehensive Guide for the Social Sciences, London: SageAdvertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Payne, G., Payne, J. (2004). Key Concepts in Social Research, London: Sage Publications Scott, J. (1990). A Matter of Record, Documentary Sources in Social Research, Cambridge: Polity Press

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Personality is built on biology- Discuss Essay Example | Topics and Well Written Essays - 250 words

Personality is built on biology- Discuss - Essay Example This paper discusses the role of stimulation of cerebral cortex in the openness of an individual to the society. Theorists have maintained the opinion that one’s biology influences one’s personality. According to Hans Eysenck, biology is the major determinant of an individual’s personality. Eysenck’s theory has invited a lot of debate conventionally, though he is frequently referred to in discussions of personality development. To say that personality is determined by biology fundamentally is a way of emphasizing upon the role of neurotransmitters, hormones, and genes in an individual’s behavior. Eysenck said that human brain regulates itself. There is an important role of stimulation of the cerebral cortex in determining the level to which an individual is social or reserved. Under-stimulation of the cerebral cortex arises the need to gain stimulus from the environment. Accordingly, the individual becomes an extrovert. On the other hand, over-stimu lation of the cerebral cortex suppresses an individual’s tendency to gain outside stimulation. This makes an individual introvert. In light of these facts, it can be said that human biology plays an important role in shaping the personality, though it is not the only factor which influences the personality. Personality is actually an outcome of both nature and nurture. This paper has discussed the nature’s role in developing the personality.

Japans Policy on Nuclear Weapons

Japans Policy on Nuclear Weapons In 1945, the United States launched two nuclear attacks on both Japanese cities, Hiroshima and Nagasaki. The two attacks not only destroyed two cities, but also killed thousands of people. Although Japan was the only country that suffered from the devastating effects of nuclear attack in World War II, Japan did not give up using and developing this technology for other uses. Japan kept using the nuclear power and technology to provide a great amount of electricity and other resources to the country. This is because Japan is a country with only a small amount of natural resources, Japan needs to depend heavily on imports for their needs. However, relying heavily on imports brings a lot of stress because the costs of imported products are very high. Therefore, Japan has changed to rely heavily on the nuclear energy. The government believed that the peaceful use of nuclear power can help Japan to become a more powerful country and reduce its stress from imports. The use of nuclear energy provides many benefits to Japans society, but it also creates problems. Japan is a country that experiences frequent earthquakes and tsunamis that are caused by the high magnitude earthquake. In this case, it is very important for the Japanese government to consider the location of where to build nuclear power plants. But the Japanese government did not consider all factors carefully, which created huge disaster later. On March 11, 2011, a huge earthquake and tsunami caused extensive damage to the Fukushima Nuclear Power Plant in Japan, which resulted in nuclear meltdowns, releases of radioactive materials into the atmosphere and oceans. Because of the release of radioactive materials into the air and ocean, the radioactive level in the atmosphere and ocean could cause huge pollution that would cause danger to people and marine life. To be specific, since it polluted the ocean, it raises the possibility that marine life and freshwater could be affected. In t his case, it causes concerns about the food safety because fish is the major ingredient of Japanese food and agriculture needs water for irrigation. If people keep eating these affected fishes and agricultural products, they might have greater possibilities of having cancers. In the end, people who lives in Japan, especially who lives near to this region, the radiation exposures could affect their health, both physically and psychologically. Therefore, it is clear that Fukushima Nuclear Power Plant disaster brought great negative effects on society, which affects Japans environment, food safety and health. The Fukushima Nuclear Power Plant disaster has caused environmental problems to Japan. Due to the accident, a large amount of radioactive materials were discharged into the environment, which polluted air, ocean, and freshwater system in enormous volume. In fact, according to Yasuo Onishi, the radionuclides with 31017 Becquerel (Bq is the SI derived unit of radioactivity) emitted into the air, and polluted land and marine life later. Some directly contaminated the Pacific Ocean[1]. Clearly, the accident caused high level of radioactive materials directly polluted the environment. And if this problem continues to be exacerbating, sooner or later it might cause greater problems like natural environment deterioration. Moreover, after this accident, radioactive materials were not only emitted into the air and ocean, but also affected the whole ecosystem later. Ecosystem divided the world into several different regions, but every region is also closely connected in certain ways. For examp le, lake aquatic ecosystem could connect with the terrestrial ecosystem, and all parts of terrestrial ecosystems like soil, forests, are connected in a very effective way through the atmosphere. In this case, if the marine, freshwater system and air were contaminated, the ecosystem would also be affected. In fact, Christopher Eddy and Eriko Sase point out in 2015, Fukushima nuclear disaster caused a catastrophic release of radiological hazards into the ecosystem. Extremely high levels of strontium, a bone-seeking radionuclide with a half-lefe of 28 years, are currently increasing in soil, groundwater, and ocean samples near the Fukushima Dai-ichi nuclear power plant.[2] Clearly, this shows that this disaster brings terrible impacts to the environment, and the situation is getting worse and worse. Therefore, Japan should put more efforts on protecting environment and finding an effective solution of reducing the level of radioactive material in the ecosystem. The negative effect of the Fukushima nuclear disaster for the environment is clear, but more importantly, it raises concern about food safety. Firstly, the food safety concerns caused by the pollution to agriculture. To explain that, this disaster caused high level of radioactive materials to directly contaminate environment, which caused great pollution to agriculture. In order to test the radioactive material contamination in agriculture, experts took some biological samples from different region to test the level of contamination. In fact, they found that in a small town in Fukushima prefecture, by testing samples from 10 rice fields, the contamination level are from 400 Bq per kilogram to 4,000 Bq per kilogram. Moreover, the result of some samples from the area named Iitatemura (20 to 30 km distant from the power plant) was very high, up to 15,031 Bq per kilogram[3]. Clearly, it demonstrates that this disaster has great negative effects on agriculture, which cause high level of c ontamination to agricultural products. In addition to the high level of contamination to agriculture, it also affected marine life. Japan is known as one of the biggest seafood consumers in the world. Seafood is often referred to as the main ingredient of Japanese food. Thus, if the marine life was contaminated by radioactive materials that have been directly discharged into the ocean, it would cause great concern about safety of fishery products. According to a report done by Tokyo Electric Power Company (TEPCO) on August 1, 2012, in some fat greenlings samples from Ota Rive which is located in the north 20 km away from the nuclear power plant, the level of radioactive materials was 25,800 Bq per kilogram, which is significantly high[4]. This result proved that the Fukushima accident has greatly affected fishery products. Therefore, the Fukushima nuclear accident creates the food safety problems to Japans society. In addition to the negative effects of Fukushima nuclear accident to environment and food safety, it also affects peoples health. After the Fukushima accident, the local governments had evacuated all people who lived in or close to the Fukushima prefecture. Thousands of people were forced to leave their homes and some of them might never come back. Many people who experienced this disaster have developed psychological problems later on because the increased fear of death from radioactive diseases and social disruption. In fact, according to Claire Leppold and her colleagues, for those people whose lives were suddenly changed, they would have greater risks of having poor health conditions, which lead them to social isolation, psychosocial stress and have higher possibility of having diseases that is not infectious, such as high blood glucose levels and diseases related to high level of lipid in the blood. As may be expected, in Fukushima, they found the number of noncmmunicable diseas es increased[5]. Clearly, it demonstrates that peoples health is greatly affected by the accident, both mentally and physically. Although it seems that this disaster has greater effects on peoples physical health rather than mental health because they have greater chances of having serious diseases, people actually have more severe mental problems later. According to a research done by Kotaro Imamura and his colleagues in 2016, mothers with small children who lived near to the power plant have higher levels of depression. Moreover, due to the extremely fear of radiation exposure, some people were very likely to experience chronic depression and anxiety, which have great chance of affecting their normal life activities[6]. It clearly shows that the disaster affected peoples mental health, and their illness was being aggravated due to the extreme fear of radiation exposure. Therefore, it is clear that the nuclear accident affects public health. Sources [1] Yasuo Onishi, Fukushima and Chernobyl Nuclear Accidents Environmental Assessments and U.S. Hanford Sites Waste Management, Procedia IUTAM 10, no. Mechanics for the World: Proceedings of the 23rd International Congress of Theoretical and Applied Mechanics (January 1, 2014): 375. ScienceDirect, EBSCOhost, accessed March 12, 2017. http://eds.b.ebscohost.com/eds/detail/detail?vid=3[emailprotected]hid=119bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=edselpAN=S2210983814000339. [2] Christopher Eddy and Eriko Sase, Implications of the Fukushima Nuclear Disaster:Man-made Hazards, Vulnerability Factors, and Risk to Environmental Health, Journalof Environmental Health 78, no.1 (July 2015):29. General Science Full Text (H.W.Wilson), EBSCOhost, accessed March 12, 2017. http://eds.b.ebscohost.com/eds/detail/[emailprotected]vid=1hid=119bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=gftAN=103698161. [3] Hrabrin Bachev and Ito Fusao, Impacts of Fukushima Nuclear Disaster on Agri-Food Chains in Japan, IUP Journal of Supply Chain Management 10, no. 4 (December 2013): 10. EBSCOhost. Accessed February 13, 2017. http://eds.a.ebscohost.com/eds/pdfviewer/[emailprotected]8vid=4hid=4205. [4] Kaoru Nakata and Hiroya Sugisaki, The Impacts of Fukushima NuclearAccident onFish andFishingGround, (SpringerOpen, 2015), (accessed February 13, 2017), 178. http://link.springer.com/book/10.1007%2F978-4-431-55537-7. [5] Claire Leppold, Tetsuya Tanimoto, Masaharu Tsubokura, Public Health after a Nuclear Disaster: Beyond Radiation Risks, Bulletin of the World HealthOrganization 94, no. 11 (November 2016): 859. General Science Full Text(H.W. Wilson), EBSCOhost, accessed February 13, 2017. http://eds.b.ebscohost.com/eds/pdfviewer/pdfviewer?sid=44563dba-77c9-4cd7-8765-ab644726f01d%40sessionmgr104vid=3hid=119. [6] Imamura Kotaro et al., The Effect of a Behavioral Activation Program on Improving Mental and Physical Health Complaints Associated with Radiation Stress among Mothers in Fukushima: A Randomized Controlled Trial, BMCPublic Health 16 (November 8, 2016): 2. Academic Search Complete,EBSCOhost, accessed February 13, 2017. http://eds.a.ebscohost.com/eds/detail/[emailprotected]vid=1hid=4205bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=a9hAN=119467986.

Production Functions and Cost Functions in Oil Pipelines Essay

1. For an 18-inch pipeline designed for 150,000 barrels per day, what is the short-run cost per barrel (per thousand miles) of transporting crude oil if the throughput is (a) 50,000 barrels per day (b) 100,000 barrels per day (c) 150,000 barrels per day? Using chart 7, a) Cost of transporting 50,000 barrels would be 30 cents. b) Cost of transporting 100,000 barrels would be 17 cents. c) Cost of transporting 150,000 barrels would 16 cents. 2. Can a 16-inch pipeline with 10,000 horsepower transport 100,000 barrels of crude oil per day? If a firm has a 20-inch pipeline, how much horsepower must be used to transport 150,000 barrels per day? This question can be approached in two ways. Both the approaches give different answers. a. Using Chart 1, a 16-inch pipeline with 10,000 horsepower will NOT be able to transport 100,000 barrels of crude oil per day. The pipeline will require at least 20,000 horsepower. If a firm has a 20-inch pipeline and wants to transport 150,000 barrels per day, they should use 20,000 horsepower. b. Using formula , T = (H) (D ) / (0.01046) When D= 16 inches H= 10,000, we get T= 349619.69 barrels. Thus, a 16 inch line pipeline with 10k horsepower can transport 100k barrels of oil. If the pipeline is 20 inch and we need to get 150k barrels of oil, using the formula, we will need 357.79 3. Does it appear that there should be many pipelines competing to transport crude oil over a particular route? Why or why not? I don’t think there would be multiple lines competing to transport crude oil over a particular route unless there is more demand than what is currently being supplied. It does not make economic sense to run pipelines at less than maximum capacity as they require a huge investment. The cost of laying the line and the materials costs of steel, pipe coating, line block valves, corrosion protection and so forth are a huge investment and would not be feasible for an oil company if the pipeline would not be supplying oil to its fullest capacity. 4. According to Leslie Cookenboo, plant D in Figure 1 â€Å"is not the optimum plant for the output at which it itself is most efficient (Q1).† How can this be? Explain. Optimum point is the point where the output costs the least per unit. The point where Q1 falls on the curve of plant E is lower than the lowest point on the curve of plant D. Therefore plant E can produce D’s optimum output more cheaply than D. 5. Leslie Cookenboo stresses the difficulties and limitations of estimating cost functions on the basis of historical cost data, rather than engineering data of the sort he uses. What are these limitations and difficulties? According to Leslie Cookenboo, where engineering estimation is feasible for cost studies it should be used, since actual costs may be subject to any number of erratic variations arising from construction or operating conditions unique to particular cases. In cases where engineering data is not available, historical data can be used, but using historical data makes the cost estimation prone to errors as it does not take into account the specific environmental factors that affect a particular situation. 6. Explain in commonsense terms why there are economies of scale in pipelines. In general, the average cost of transporting a barrel of oil decreases as total throughput increases. That is, oil pipelines are characterized by  economies of scale. There are several reasons for this: a) Setup Costs: The cost planning, design and installation are fixed setup costs. b) Volumetric Returns to Scale: Oil Pipelines are characterized by volumetric returns to scale. This happens because the cost of steel depends on its surface area while the capacity of the pipeline depends on its volume. Also, the amount of horsepower required is determined by resistance to flow which is decreasing in the diameter of the pipe. In the case, the production function is estimated as: This production function is characterized by increasing returns to scale. Doubling line diameter and horsepower leads to more than a fourfold increase in output but only a doubling in costs. c) Long run fixed costs: The cost of the personnel that monitor the pipelines is a long-run fixed cost due to the fact that a minimum number of personnel is required to monitor the pipelines regardless of the throughput. d) For the same level of reliability, larger pipelines require relatively fewer pumps in reserve. 7. Leslie Cookenboo has been senior economics adviser in the corporate planning department of Exxon Corporation. In what ways might Exxon have made use of his findings? Leslie Cookenboo’s study has 3 major findings: a. Economies of scale characteristic of the operation of pipe lines require that oil must be carried conglomerated in as large quantities as is possible in large diameter lines. This gives the least transportation costs obtainable. Exxon can reduce its transportation costs by transporting oil in large quantities in large diameter lines. b. Pipelines should not be run at throughputs appreciably below capacity; otherwise higher costs per barrel will be incurred than need be. Exxon can avoid higher costs per barrel by operating the pipelines at maximum capacity. c. Capacity of a large line can be expanded appreciably without increasing average costs. Decreased average costs can be obtained with moderate expansions.

Vacant Chapter 8 Celebrate

â€Å"Happy anniversary!† Emily yells at me as I exit the bathroom having just completed my morning ritual. She'd be disgusted if she knew everything it entailed, not to mention the full coverage robe I was supposed to buy, which means Emily still walks around in tiny towels. Of course, I spend extra time in the shower stroking out my morning wood so that I'm able to have some semblance of decency the rest of the day. Walking around with an Emily induced boner would certainly make our situation uncomfortable. While the topic of dating and relationships hasn't been broached since January, that doesn't mean it has gone away. Instead, it's been the elephant in the room for eight long months. â€Å"Is there an anniversary song?† Emily asks jokingly. â€Å"There's one for birthdays.† She starts singing Happy Birthday, replacing â€Å"birthday† with â€Å"anniversary.† I can't help but smile given the joy the woman before me holds for the simplest of things. â€Å"It's two years today, Ethan; two years ago you came over and opened my window, two years since you recognized I was alone and in need. Two years ago you opened your home and heart to a perfect stranger.† When she says heart quieter than the rest, mine skips a beat. Her voice wavers at the end of her speech, indicating tears are about to follow. I reach out to her, pull her into me, and hold her tightly as she surrenders to the sadness. This is the only touch I'm allowed – the only appropriate embrace. Looking in the mirror, I see a man whose extraordinarily proud. While I may not be the mama bird watching her baby bird fly from the nest, there is still pride deep in my chest. Emily graduates today from high school. It's an accomplishment, which given the circumstances, is astounding. Today is special, and it's the first time I've ever worn a tie, so I check it one last time. My tie isn't the only surprise I have for Emily today. I purchased my very first car this morning, and I plan to drive Emily to her graduation in a 1998 Toyota Corolla. It belonged to Margie, my boss, but her husband bought her a new one. He sold me the Corolla with 160,000 miles at an unreasonably low price. I'd say he was giving me a bit of charity, but no matter, it's mine. Mine and Emily's. â€Å"Get-out!† Emily shouts moments later as she looks at the champagne colored car parked on the street and then back at me. Her mouth is hanging open, unsure of what to say. â€Å"Come on; get in. We have a graduation to get to.† â€Å"Your brother is way hot,† I hear the blonde say. Emily doesn't respond, but another high-pitched voice does. â€Å"That's not her brother, you clueless bitch.† Emily told me about this once, where females call each other names as terms of endearment, but I don't get it. If one of the guys at the store called me a bastard or asshole, I'd punch his face, endearment aside. â€Å"Gretchen†¦Ã¢â‚¬  I hear Emily plead. â€Å"Please don't.† â€Å"What? He's not – which, of course begs the question, why aren't you bangin' his brains out, little Emily Evans?† Truth be told, I want to know Emily's response. It's not like I haven't thought about it a thousand times, but I'm curious to know if she thinks about it too. â€Å"I have to – † then I hear footsteps rapidly retreating. I decide to make myself known and walk out of the hallway where I've been hiding since the conversation seems to be over. â€Å"Hey, Ethan, you just missed Emily.† The blonde motions down the hall in the direction Emily went. I follow. The sound hits me immediately as I near a classroom with an open door. Thankfully, it's a sound I haven't heard for a while, but hearing it now cuts me like a hot knife through cold butter. â€Å"Emily?† I call to her as I enter the nearly empty room. The desks and chairs are stacked, waiting patiently for another round of students in the fall. Emily looks up, red-faced and glassy-eyed. She regards me for a moment, then bursts into another round of sobs. For a second, I think about how ugly crying is. I think Emily is beautiful, but the way her face contorts†¦ it's just so unattractive. This crying mess in front of me doesn't look like Emily at all. Then the few remaining scraps of humanity I think I have left kick in, and those superficial and negative thoughts float away. All I'm seeing now is my Emily in pain – and I want to make it stop. I go to her as fast as my legs can carry me and take her in my arms, holding her close. We've only embraced a few times, but for me, it's special every time. After several minutes, Emily has calmed and she raises her head to look at me. Her eyes are clear now, and as she gazes into my eyes, I think about how beautiful she is. It's all I can do not to place my lips over hers. We're so close that just a few inches forward would connect us. I want her so much sometimes it's hurts. But that's not meant to be, and my sinful thoughts have to remain hidden. â€Å"Ethan, I have to tell you something. Well, ask you something, really. I mean I'm going to tell you something, but then I'm going to – † I cut her off by placing my hand gently over her mouth. She rambles when she's nervous, plus my hand will keep me from kissing her. â€Å"Deep breath,† I coach her and myself. After a few relaxing sighs, I encourage her to start again. â€Å"You can tell me anything, Emily. I'm here for you. You can trust me.† But never in a million years would I expect what she says next. â€Å"Ethan, I love you.†

The risk of innovation with financial firms - Free Essay Example

Sample details Pages: 3 Words: 995 Downloads: 3 Date added: 2017/06/26 Category Finance Essay Type Argumentative essay Did you like this example? Throughout history it has been observed that financial institutions have often failed. Some of the most common reasons for this can be attributed to regulation, either lack of or too much. Risk is often cyclical in nature, when the market is in an upswing most financial institutions will increase their appetite for risk and when the market is in a downturn, financial institutions will cut back on lending and increase their reserves (Peretez et al, 2009, p.609). Don’t waste time! Our writers will create an original "The risk of innovation with financial firms" essay for you Create order Markets respond to changing conditions in search of increased profitability (UOL Lecture Notes, 2011). Changing conditions thus support the foundation of financial innovation, in which many of these institutions seek to achieve the highest possible profits sometimes with inappropriate risk taking and total disregard for possible outcomes. Why do Financial Firms Innovate and Maintain an Appetite for Risk? Banks are mainly regulated in order to protect the interest of its depositors (liabilities) and limit risk taking which is known as prudential regulation (Kohn, 2004, p.595). Because bank balance sheets are often mismatched short-term liabilities (deposit funds) against longer term assets (loans) it leaves the bank more open to adverse shocks such as bank runs. While banks are often covered by depositors insurance, this is not always effective in preventing a bank run because depositors will often react to what others are doing. Deposit insurance as well as lenders of last resorts such as Central Banks essentially allows depositors some reassurance; however this can also be an incentive for banks to engage in riskier behavior. While certain regulations have been put in place to deter risky behavior, evidence shows that many financial institutions have sought out ways to maneuver around regulations. This is most often in an attempt to enhance profitability through the creation of other types of assets. According to Calomiris (2009, p. 65) financial innovations often respond to regulation by sidestepping regulatory restrictions that would otherwise limit activities in which people wish to engage. Banks are not the only financial intermediaries which are regulated. The securities market which involves institutional investors and arms length investors also require protection. The main reasons why these investors need protection are to guard against cheating and instability (Kohn, 2004, p. 637). Different countries have different regulation requirements. For example the UK and US use the Anglo model which serves to monitor and reinforce the market, and the Continental model is moreover used by Europe and Asia which has a more direct influence and control over the market (UOL Lecture Notes, 2011). The most important determinant of banks and other financial intermediaries is the inherent liquidity risk issue. It is of utmost importance that liquidity risk i s markedly monitored. Illiquidity for a financial institution poses a threat to its continued success. Lack of liquid resources ultimately leads to failure. There are two ways in which banks can manage liquidity risk, internal and external. Internal risk management entails the bank holding reserves as well as matching maturities and currency denominations of its assets and liabilities. External management involves the reliability of obtaining funding from outside resources while hedging with the use of derivatives to minimize risk (Kohn, 2004, p.603). There have been an incredible amount of arguments which relate to the regulations of these institutions in regards to their use and abuse of financial innovation. But a question arises? Is all financial innovation bad? Some say that financial innovation is a necessary component that can stimulate economic growth, but is widely dependent on how it is used and others say it serves no purpose. For example according to Litan (n.d.) who cites Volckers views on financial innovation who was a former Federal Reserve Board Chairman in the US, that there have been no other recent financial innovations that have contributed to the finance industry recently other than the ATM machine. He further notes that Volckers reasoning for this could be attributed to economic development over time from the 1950s up to the 1980s where financial innovations such as CDSs and CDOs were of no importance to continued growth and stability of the economy. However according to Litan (n.d.), there are many other financial innovations which have been contributory to the growth of the economy which include, credit cards, debit cards, mobile banking, internet banking and a host of other examples. However, more recently bad financial innovations as some would call it, such as CDSs and CDOs were largely blamed for the collapse of the US Housing Market or subprime crisis. Conclusion: In conclusion, it seems very apparent to me that while some lay blame on certain financial innovations wreaking havoc which resulted in a global systemic crisis, it doesnt appear in itself that the financial innovations such as CDOs and CDSs were directly to be blamed, but rather the lack of regulation surrounding the issuance of such instruments. Perhaps if the government had intervened rather than turning a blind eye to something that was on the verge of being out of control by posing restrictions in a bid to tighten mortgage activity, the fall wouldnt have been as harsh, and there might have been less fall in asset values. From my point of view, financial innovations arent really bad; its how they are used. Last and but not least I conclude with a very interesting statement made by Litan (n.d.) who notes what has been called regulatory dialectic in finance new rules aimed at preventing old abuses being circumvented by yet new innovations, and yes sometimes by new abuses is as old as finance itself. Which leads me to believe that no matter how much one rehashes the ideas surrounding financial innovation, the fact remains that there will always be individuals and institutions who are seeking higher profits and thus find a way around those rules even if it entails risky behavior. In short rules and regulations can be in place, and new rules can replace old rules to accommodate new trends, but there will always be mistakes and arent new rules made to amend those mistakes?