Foreign Debt Crisis Management free essay sample

The topic of assignment is to study the debt crisis management and impact of un-hedged exposure aspects of RCom – a major Telecom Service provider in India. RCom has entered in high-debt levels i. e Rs 35000 crore and it has been further compounded because of the steep depreciation of the rupee, where nearly three-fourths of Loan is in foreign currency. RCom has implemented refinancing strategy for the loan outstanding by Industrial and Commercial Bank of China (ICBC), China Development Bank (CDB), Export Import Bank of China (EXIM), and other banks. This strategy will be benefited from extended loan maturity of seven years and attractive interest cost of about 5 per cent and the loan would be used for refinancing the entire redemption amount of FCCB. In this assignment, I have studied the financial crisis management part which is managed by the company with some strategic move of loan refinancing and a smart move of fund raising through listing of Flag telecommunication at Singapore and set an indicative price range for the Singapore initial public offering of its undersea cable unit (Flag Telecommunication) that could raise as much as $1 billion and help to reduce its debt load. We will write a custom essay sample on Foreign Debt Crisis Management or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page I have also studied the impact of heavy debt on companys financial credit worthiness and impact of rupee devaluation on overseas loan taken from China and loss incurred due to huge exposure of un-hedged transactions. Reliance Communications Limited is the flagship Company of Reliance Group, one of the leading business houses in India. Reliance Communications is India’s foremost and truly integrated telecommunications service provider. The Company, with a customer base of 152 million as on March 31, 2012 including over 2. million individual overseas retail customers, ranks among the Top 4 Telecom companies in the world by number of customers in a single country. Reliance Communications corporate clientele includes over 35,000 Indian and multinational corporations including small and medium enterprises and over 800 global, regional and domestic carriers. Reliance Communications has established a pan-India, next generation, integrated (wireless and wire line), convergent (voice, data and video) digital network that is capable of supporting best-of-class services spanning the entire communications value chain, covering over 24,000 towns and 600,000 villages. Reliance Communications owns and operates the world’s largest next generation IP enabled connectivity infrastructure, comprising over 277000 kilometers of fiber optic cable systems in India, USA, Europe, Middle East and the Asia Pacific region. Assignment analysis and study RCom has entered in high-debt levels i. e Rs 35000 crore because of high capital investment for changes in industry landscape, rapid emergence of newer business opportunities like 3G, mobile broadband data, etc, and evolving regulatory framework. RCom continues to actively evaluate and execute the most relevant organization structure to address the market opportunity. In the 2 years, RCOM has taken several measures to reduce its mounting debts. 1. Reliance Communications has secured loans from a host of Chinese banks to refinance $1. 18 billion worth of outstanding foreign currency bonds due for redemption. The deal has provided RCOM a major support, where company is trying for more than a year to sell its telecoms tower unit to cut the companys about $6. 5 billion debt. Reliance Communications said Industrial and Commercial Bank of China, China Development Bank Corp, Export Import Bank of China and other banks were funding the refinancing of the outstanding foreign currency convertible bonds (FCCBs). The company said it would benefit from extended loan maturity of seven years and attractive interest cost of about 5 percent, sending its shares up as much as 5. 7 percent in a Mumbai market that rose 1. 5 percent. The FCCBs were issued in February 2007 when the Indian markets were booming, with a conversion price of 654 rupees a share. Cut-throat competition among Indias mobile phone operators has since hit earnings and shares have plunged. Reliance Communications shares were trading around 90 rupees, a fraction of the conversion price. Reliance Communications has talked with China Development Bank for a syndicated loan to redeem the bond. China Development Bank arranged loans worth $1. 93 billion for Reliance Communications, which the company used to finance radio airwaves it acquired during a costly 3G auction, as well as for the purchase of equipment. With its bruising debt load and a ferociously competitive 15-operator arket, Reliance Communications has reported eight straight quarters of falling profits. Reliance communications has tried once again and talked with U. S. buyout giants Carlyle Group and Blackstone Group on a deal for the towers business which could be worth more than $3 billion, but unfortunately the deal is not closed to completion. 2. RCom has filed a prospectus with the Singapore Stock Exchan ge and plans to divest as much as 75% stake in Flag Telecom to raise about $1 Billion- Reliance Communications was looking to secure a leasing agreement for its towers from Reliance Industries, before pressing forward with a tower sale. It has also not settled. The efforts to sell a majority stake in Reliance Infratel are still to fructify, in the mean time company has decided the listing of Reliance Globalcom. , where the Reliance Globalcom can help the company to raise Rs 50 billion-Rs 65 billion by divesting 75 per cent stake in its submarine cable business. The issue has opened at a price range of $1. 09-$1. 32 per unit. The bankers for the issue include Deutsche Bank, DBS of Singapore, Standard Chartered and the Industrial and Commercial Bank of China. Reliance Globalcom will be listed under the business trust structure. Post the listing, the company’s submarine assets and business will continue to be controlled by the existing management. RCOM will continue to hold the remaining 25 per cent equity stake. A. Background of Reliance Globacom Reliance Globalcom was formed in 2003 as a result of an amalgamation of Flag Telecom with the Reliance Group for $207 million. Flag, which had emerged from bankruptcy proceedings and had been on the block for over a year before being acquired by Reliance, was reeling under losses. However, the acquisition gave Reliance a foothold in the global business arena with over 50,000 km of submarine cables, thereby ending Tata Communications’ monopoly in the undersea cable field. From 2005, Flag embarked on an expansion path and finally broke even in September 2006. It introduced several higher-value-added products, including international private leased circuits (IPLCs), virtual private networks (VPNs) and Ethernet services. This accelerated the company’s revenue growth and increased its profitability. Flag Telecom later came into the fold of RCOM, led by Anil Ambani, after the Reliance Group’s businesses were split between the brothers, Mukesh and Anil Ambani. In 2008, the company was integrated into RCOM’s international operations under the Reliance Globalcom brand. B. Cable network of Flag Telecom Reliance Globalcom owns the largest private cable network in the world with over 277,000 route km of fibre optic cables. This includes 68,000 km of subsea fibre. Through strategic relationships with over 750 network service providers across the world, Reliance Globalcom provides assured connectivity to 163 territories worldwide. This makes RCOM a carrier’s carrier as it provides global connectivity solutions to carriers and internet communities through its submarine cable system. The company has cable landing tie-ups across 46 locations in 26 countries with 31 partners. The company’s global backbone spans four continents, connecting key business markets in Asia, Europe, the Middle East and the US. The network consists of five cable systems – FLAG Europe Asia (FEA), FLAG North Asian Loop (FNAL), FLAG Atlantic 1 (FA-1), FLAG Alcatel-Lucent Optical Network (FALCON) and HAWK. The company also owns and operates a low latency, global MPLS-based IP network, which connects most of the world’s principal international internet exchanges. FNAL represents a part of the 9,800 km North Asian Loop submarine, an intra-Asia submarine cable system that links Japan, Korea, Taiwan and Hong Kong in a ring configuration. The entire FNAL submarine cable system consists of six pairs of fibre, three of which are owned by Reliance Globalcom.

Documentary Research

Documentary Research Introduction Documentary research is a type of academic research that employs the use of source materials such as documents and texts for studying a specific research topic. Source materials used in this form of research may include newspapers, census results, story books, government publications, diaries, videos, works of art certificates visual and photographic items done on paper and so on.Advertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Documentary research is the most commonly used type of research document amongst the three major social research methods (Scott 1990). Literature review on the other hand refers to a given body of secondary text of an existing document. These documents can either be published or unpublished documents meant to review important points of knowledge needed to carry out comprehensive findings to a given research topic. It gives an general idea of both theory and methodology of a specific research topic (Hart 2001). Discussion Documentary research process employs the use of conceptualizing methods in document review and use. It involves the use of ether qualitative or quantitative research analysis skills, or it may sometimes employ the use of both techniques to study a specific research topic. Documentary research process in research academic work helps to support the researchers referencing skills. The information used in documentary research can be either primary or secondary, and involves the use of external sources to defend the debate of a given research academic work. Payne (2004, pg. 222) defines the documentary research as a research technique used to group, explore, deduce and find out the weaknesses of physical sources, frequently written materials both in private and public sectors (Payne 2004, pg. 222). To achieve a good documentary research paper, there should be a clear structure of ideas relating to the to pic of study with the proper use of key words to ease the search. Documentary research comes prior to the literature review and hence, proper time management is a priority in carrying out this study. Literature review, on the other hand, usually comes after a research proposal and its deliverables. It involves the analysis of originally obtained information to review the acquired information and the significance of this information to the research topic. It achieves the purpose of updating the reader with the current reviews on a particular research topic and builds groundwork for future research studies in the same research area.Advertising Looking for assessment on education? Let's see if we can help you! Get your first paper with 15% OFF Learn More It also aids the researcher in highlighting areas of further research, which opens up the researcher’s scope for further studies (Grix 2000, pg 228). Literature review involves critique argument in that i t debates for or against the research topic. This argument helps to confirm or rule out arguments improving the entire quality of the study. It also highlights vital issues of past literature and how the literature relates with the current topic of study. The writing must involve the use of a logical flow of ideas, updated references relevant to the research topic and a consistent use of reference style. Conclusion In concluding, the fundamental requirement when writing either a documentary research or a literature review is the quality and relevance of the paper in connection to the research topic. These research approaches needs a keen consideration of research standards when carrying out a research on a particular research topic. It is necessary when carrying out research to be aware that, there are many unrecognized sources of information in the web. These unrecognized sources of information pose a great danger in both documentary research and literature review writing. The rele vance and value of these web documents must pass through a proper assessment before applying them in writing documentary research or literature review. The assessment can undergo four basic factors such as authenticity, material representativeness, paper credibility and meaning. References Grix, J. (2001). Demystifying Postgraduate Research, 3rd ed. Birmingham: University of Birmingham University Press Hart, C. (2001). A Comprehensive Guide for the Social Sciences, London: SageAdvertising We will write a custom assessment sample on Documentary Research specifically for you for only $16.05 $11/page Learn More Payne, G., Payne, J. (2004). Key Concepts in Social Research, London: Sage Publications Scott, J. (1990). A Matter of Record, Documentary Sources in Social Research, Cambridge: Polity Press

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Personality is built on biology- Discuss Essay Example | Topics and Well Written Essays - 250 words

Personality is built on biology- Discuss - Essay Example This paper discusses the role of stimulation of cerebral cortex in the openness of an individual to the society. Theorists have maintained the opinion that one’s biology influences one’s personality. According to Hans Eysenck, biology is the major determinant of an individual’s personality. Eysenck’s theory has invited a lot of debate conventionally, though he is frequently referred to in discussions of personality development. To say that personality is determined by biology fundamentally is a way of emphasizing upon the role of neurotransmitters, hormones, and genes in an individual’s behavior. Eysenck said that human brain regulates itself. There is an important role of stimulation of the cerebral cortex in determining the level to which an individual is social or reserved. Under-stimulation of the cerebral cortex arises the need to gain stimulus from the environment. Accordingly, the individual becomes an extrovert. On the other hand, over-stimu lation of the cerebral cortex suppresses an individual’s tendency to gain outside stimulation. This makes an individual introvert. In light of these facts, it can be said that human biology plays an important role in shaping the personality, though it is not the only factor which influences the personality. Personality is actually an outcome of both nature and nurture. This paper has discussed the nature’s role in developing the personality.

Japans Policy on Nuclear Weapons

Japans Policy on Nuclear Weapons In 1945, the United States launched two nuclear attacks on both Japanese cities, Hiroshima and Nagasaki. The two attacks not only destroyed two cities, but also killed thousands of people. Although Japan was the only country that suffered from the devastating effects of nuclear attack in World War II, Japan did not give up using and developing this technology for other uses. Japan kept using the nuclear power and technology to provide a great amount of electricity and other resources to the country. This is because Japan is a country with only a small amount of natural resources, Japan needs to depend heavily on imports for their needs. However, relying heavily on imports brings a lot of stress because the costs of imported products are very high. Therefore, Japan has changed to rely heavily on the nuclear energy. The government believed that the peaceful use of nuclear power can help Japan to become a more powerful country and reduce its stress from imports. The use of nuclear energy provides many benefits to Japans society, but it also creates problems. Japan is a country that experiences frequent earthquakes and tsunamis that are caused by the high magnitude earthquake. In this case, it is very important for the Japanese government to consider the location of where to build nuclear power plants. But the Japanese government did not consider all factors carefully, which created huge disaster later. On March 11, 2011, a huge earthquake and tsunami caused extensive damage to the Fukushima Nuclear Power Plant in Japan, which resulted in nuclear meltdowns, releases of radioactive materials into the atmosphere and oceans. Because of the release of radioactive materials into the air and ocean, the radioactive level in the atmosphere and ocean could cause huge pollution that would cause danger to people and marine life. To be specific, since it polluted the ocean, it raises the possibility that marine life and freshwater could be affected. In t his case, it causes concerns about the food safety because fish is the major ingredient of Japanese food and agriculture needs water for irrigation. If people keep eating these affected fishes and agricultural products, they might have greater possibilities of having cancers. In the end, people who lives in Japan, especially who lives near to this region, the radiation exposures could affect their health, both physically and psychologically. Therefore, it is clear that Fukushima Nuclear Power Plant disaster brought great negative effects on society, which affects Japans environment, food safety and health. The Fukushima Nuclear Power Plant disaster has caused environmental problems to Japan. Due to the accident, a large amount of radioactive materials were discharged into the environment, which polluted air, ocean, and freshwater system in enormous volume. In fact, according to Yasuo Onishi, the radionuclides with 31017 Becquerel (Bq is the SI derived unit of radioactivity) emitted into the air, and polluted land and marine life later. Some directly contaminated the Pacific Ocean[1]. Clearly, the accident caused high level of radioactive materials directly polluted the environment. And if this problem continues to be exacerbating, sooner or later it might cause greater problems like natural environment deterioration. Moreover, after this accident, radioactive materials were not only emitted into the air and ocean, but also affected the whole ecosystem later. Ecosystem divided the world into several different regions, but every region is also closely connected in certain ways. For examp le, lake aquatic ecosystem could connect with the terrestrial ecosystem, and all parts of terrestrial ecosystems like soil, forests, are connected in a very effective way through the atmosphere. In this case, if the marine, freshwater system and air were contaminated, the ecosystem would also be affected. In fact, Christopher Eddy and Eriko Sase point out in 2015, Fukushima nuclear disaster caused a catastrophic release of radiological hazards into the ecosystem. Extremely high levels of strontium, a bone-seeking radionuclide with a half-lefe of 28 years, are currently increasing in soil, groundwater, and ocean samples near the Fukushima Dai-ichi nuclear power plant.[2] Clearly, this shows that this disaster brings terrible impacts to the environment, and the situation is getting worse and worse. Therefore, Japan should put more efforts on protecting environment and finding an effective solution of reducing the level of radioactive material in the ecosystem. The negative effect of the Fukushima nuclear disaster for the environment is clear, but more importantly, it raises concern about food safety. Firstly, the food safety concerns caused by the pollution to agriculture. To explain that, this disaster caused high level of radioactive materials to directly contaminate environment, which caused great pollution to agriculture. In order to test the radioactive material contamination in agriculture, experts took some biological samples from different region to test the level of contamination. In fact, they found that in a small town in Fukushima prefecture, by testing samples from 10 rice fields, the contamination level are from 400 Bq per kilogram to 4,000 Bq per kilogram. Moreover, the result of some samples from the area named Iitatemura (20 to 30 km distant from the power plant) was very high, up to 15,031 Bq per kilogram[3]. Clearly, it demonstrates that this disaster has great negative effects on agriculture, which cause high level of c ontamination to agricultural products. In addition to the high level of contamination to agriculture, it also affected marine life. Japan is known as one of the biggest seafood consumers in the world. Seafood is often referred to as the main ingredient of Japanese food. Thus, if the marine life was contaminated by radioactive materials that have been directly discharged into the ocean, it would cause great concern about safety of fishery products. According to a report done by Tokyo Electric Power Company (TEPCO) on August 1, 2012, in some fat greenlings samples from Ota Rive which is located in the north 20 km away from the nuclear power plant, the level of radioactive materials was 25,800 Bq per kilogram, which is significantly high[4]. This result proved that the Fukushima accident has greatly affected fishery products. Therefore, the Fukushima nuclear accident creates the food safety problems to Japans society. In addition to the negative effects of Fukushima nuclear accident to environment and food safety, it also affects peoples health. After the Fukushima accident, the local governments had evacuated all people who lived in or close to the Fukushima prefecture. Thousands of people were forced to leave their homes and some of them might never come back. Many people who experienced this disaster have developed psychological problems later on because the increased fear of death from radioactive diseases and social disruption. In fact, according to Claire Leppold and her colleagues, for those people whose lives were suddenly changed, they would have greater risks of having poor health conditions, which lead them to social isolation, psychosocial stress and have higher possibility of having diseases that is not infectious, such as high blood glucose levels and diseases related to high level of lipid in the blood. As may be expected, in Fukushima, they found the number of noncmmunicable diseas es increased[5]. Clearly, it demonstrates that peoples health is greatly affected by the accident, both mentally and physically. Although it seems that this disaster has greater effects on peoples physical health rather than mental health because they have greater chances of having serious diseases, people actually have more severe mental problems later. According to a research done by Kotaro Imamura and his colleagues in 2016, mothers with small children who lived near to the power plant have higher levels of depression. Moreover, due to the extremely fear of radiation exposure, some people were very likely to experience chronic depression and anxiety, which have great chance of affecting their normal life activities[6]. It clearly shows that the disaster affected peoples mental health, and their illness was being aggravated due to the extreme fear of radiation exposure. Therefore, it is clear that the nuclear accident affects public health. Sources [1] Yasuo Onishi, Fukushima and Chernobyl Nuclear Accidents Environmental Assessments and U.S. Hanford Sites Waste Management, Procedia IUTAM 10, no. Mechanics for the World: Proceedings of the 23rd International Congress of Theoretical and Applied Mechanics (January 1, 2014): 375. ScienceDirect, EBSCOhost, accessed March 12, 2017. http://eds.b.ebscohost.com/eds/detail/detail?vid=3[emailprotected]hid=119bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=edselpAN=S2210983814000339. [2] Christopher Eddy and Eriko Sase, Implications of the Fukushima Nuclear Disaster:Man-made Hazards, Vulnerability Factors, and Risk to Environmental Health, Journalof Environmental Health 78, no.1 (July 2015):29. General Science Full Text (H.W.Wilson), EBSCOhost, accessed March 12, 2017. http://eds.b.ebscohost.com/eds/detail/[emailprotected]vid=1hid=119bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=gftAN=103698161. [3] Hrabrin Bachev and Ito Fusao, Impacts of Fukushima Nuclear Disaster on Agri-Food Chains in Japan, IUP Journal of Supply Chain Management 10, no. 4 (December 2013): 10. EBSCOhost. Accessed February 13, 2017. http://eds.a.ebscohost.com/eds/pdfviewer/[emailprotected]8vid=4hid=4205. [4] Kaoru Nakata and Hiroya Sugisaki, The Impacts of Fukushima NuclearAccident onFish andFishingGround, (SpringerOpen, 2015), (accessed February 13, 2017), 178. http://link.springer.com/book/10.1007%2F978-4-431-55537-7. [5] Claire Leppold, Tetsuya Tanimoto, Masaharu Tsubokura, Public Health after a Nuclear Disaster: Beyond Radiation Risks, Bulletin of the World HealthOrganization 94, no. 11 (November 2016): 859. General Science Full Text(H.W. Wilson), EBSCOhost, accessed February 13, 2017. http://eds.b.ebscohost.com/eds/pdfviewer/pdfviewer?sid=44563dba-77c9-4cd7-8765-ab644726f01d%40sessionmgr104vid=3hid=119. [6] Imamura Kotaro et al., The Effect of a Behavioral Activation Program on Improving Mental and Physical Health Complaints Associated with Radiation Stress among Mothers in Fukushima: A Randomized Controlled Trial, BMCPublic Health 16 (November 8, 2016): 2. Academic Search Complete,EBSCOhost, accessed February 13, 2017. http://eds.a.ebscohost.com/eds/detail/[emailprotected]vid=1hid=4205bdata=JnNpdGU9ZWRzLWxpdmUmc2NvcGU9c2l0ZQ==#db=a9hAN=119467986.

Production Functions and Cost Functions in Oil Pipelines Essay

1. For an 18-inch pipeline designed for 150,000 barrels per day, what is the short-run cost per barrel (per thousand miles) of transporting crude oil if the throughput is (a) 50,000 barrels per day (b) 100,000 barrels per day (c) 150,000 barrels per day? Using chart 7, a) Cost of transporting 50,000 barrels would be 30 cents. b) Cost of transporting 100,000 barrels would be 17 cents. c) Cost of transporting 150,000 barrels would 16 cents. 2. Can a 16-inch pipeline with 10,000 horsepower transport 100,000 barrels of crude oil per day? If a firm has a 20-inch pipeline, how much horsepower must be used to transport 150,000 barrels per day? This question can be approached in two ways. Both the approaches give different answers. a. Using Chart 1, a 16-inch pipeline with 10,000 horsepower will NOT be able to transport 100,000 barrels of crude oil per day. The pipeline will require at least 20,000 horsepower. If a firm has a 20-inch pipeline and wants to transport 150,000 barrels per day, they should use 20,000 horsepower. b. Using formula , T = (H) (D ) / (0.01046) When D= 16 inches H= 10,000, we get T= 349619.69 barrels. Thus, a 16 inch line pipeline with 10k horsepower can transport 100k barrels of oil. If the pipeline is 20 inch and we need to get 150k barrels of oil, using the formula, we will need 357.79 3. Does it appear that there should be many pipelines competing to transport crude oil over a particular route? Why or why not? I don’t think there would be multiple lines competing to transport crude oil over a particular route unless there is more demand than what is currently being supplied. It does not make economic sense to run pipelines at less than maximum capacity as they require a huge investment. The cost of laying the line and the materials costs of steel, pipe coating, line block valves, corrosion protection and so forth are a huge investment and would not be feasible for an oil company if the pipeline would not be supplying oil to its fullest capacity. 4. According to Leslie Cookenboo, plant D in Figure 1 â€Å"is not the optimum plant for the output at which it itself is most efficient (Q1).† How can this be? Explain. Optimum point is the point where the output costs the least per unit. The point where Q1 falls on the curve of plant E is lower than the lowest point on the curve of plant D. Therefore plant E can produce D’s optimum output more cheaply than D. 5. Leslie Cookenboo stresses the difficulties and limitations of estimating cost functions on the basis of historical cost data, rather than engineering data of the sort he uses. What are these limitations and difficulties? According to Leslie Cookenboo, where engineering estimation is feasible for cost studies it should be used, since actual costs may be subject to any number of erratic variations arising from construction or operating conditions unique to particular cases. In cases where engineering data is not available, historical data can be used, but using historical data makes the cost estimation prone to errors as it does not take into account the specific environmental factors that affect a particular situation. 6. Explain in commonsense terms why there are economies of scale in pipelines. In general, the average cost of transporting a barrel of oil decreases as total throughput increases. That is, oil pipelines are characterized by  economies of scale. There are several reasons for this: a) Setup Costs: The cost planning, design and installation are fixed setup costs. b) Volumetric Returns to Scale: Oil Pipelines are characterized by volumetric returns to scale. This happens because the cost of steel depends on its surface area while the capacity of the pipeline depends on its volume. Also, the amount of horsepower required is determined by resistance to flow which is decreasing in the diameter of the pipe. In the case, the production function is estimated as: This production function is characterized by increasing returns to scale. Doubling line diameter and horsepower leads to more than a fourfold increase in output but only a doubling in costs. c) Long run fixed costs: The cost of the personnel that monitor the pipelines is a long-run fixed cost due to the fact that a minimum number of personnel is required to monitor the pipelines regardless of the throughput. d) For the same level of reliability, larger pipelines require relatively fewer pumps in reserve. 7. Leslie Cookenboo has been senior economics adviser in the corporate planning department of Exxon Corporation. In what ways might Exxon have made use of his findings? Leslie Cookenboo’s study has 3 major findings: a. Economies of scale characteristic of the operation of pipe lines require that oil must be carried conglomerated in as large quantities as is possible in large diameter lines. This gives the least transportation costs obtainable. Exxon can reduce its transportation costs by transporting oil in large quantities in large diameter lines. b. Pipelines should not be run at throughputs appreciably below capacity; otherwise higher costs per barrel will be incurred than need be. Exxon can avoid higher costs per barrel by operating the pipelines at maximum capacity. c. Capacity of a large line can be expanded appreciably without increasing average costs. Decreased average costs can be obtained with moderate expansions.

Vacant Chapter 8 Celebrate

â€Å"Happy anniversary!† Emily yells at me as I exit the bathroom having just completed my morning ritual. She'd be disgusted if she knew everything it entailed, not to mention the full coverage robe I was supposed to buy, which means Emily still walks around in tiny towels. Of course, I spend extra time in the shower stroking out my morning wood so that I'm able to have some semblance of decency the rest of the day. Walking around with an Emily induced boner would certainly make our situation uncomfortable. While the topic of dating and relationships hasn't been broached since January, that doesn't mean it has gone away. Instead, it's been the elephant in the room for eight long months. â€Å"Is there an anniversary song?† Emily asks jokingly. â€Å"There's one for birthdays.† She starts singing Happy Birthday, replacing â€Å"birthday† with â€Å"anniversary.† I can't help but smile given the joy the woman before me holds for the simplest of things. â€Å"It's two years today, Ethan; two years ago you came over and opened my window, two years since you recognized I was alone and in need. Two years ago you opened your home and heart to a perfect stranger.† When she says heart quieter than the rest, mine skips a beat. Her voice wavers at the end of her speech, indicating tears are about to follow. I reach out to her, pull her into me, and hold her tightly as she surrenders to the sadness. This is the only touch I'm allowed – the only appropriate embrace. Looking in the mirror, I see a man whose extraordinarily proud. While I may not be the mama bird watching her baby bird fly from the nest, there is still pride deep in my chest. Emily graduates today from high school. It's an accomplishment, which given the circumstances, is astounding. Today is special, and it's the first time I've ever worn a tie, so I check it one last time. My tie isn't the only surprise I have for Emily today. I purchased my very first car this morning, and I plan to drive Emily to her graduation in a 1998 Toyota Corolla. It belonged to Margie, my boss, but her husband bought her a new one. He sold me the Corolla with 160,000 miles at an unreasonably low price. I'd say he was giving me a bit of charity, but no matter, it's mine. Mine and Emily's. â€Å"Get-out!† Emily shouts moments later as she looks at the champagne colored car parked on the street and then back at me. Her mouth is hanging open, unsure of what to say. â€Å"Come on; get in. We have a graduation to get to.† â€Å"Your brother is way hot,† I hear the blonde say. Emily doesn't respond, but another high-pitched voice does. â€Å"That's not her brother, you clueless bitch.† Emily told me about this once, where females call each other names as terms of endearment, but I don't get it. If one of the guys at the store called me a bastard or asshole, I'd punch his face, endearment aside. â€Å"Gretchen†¦Ã¢â‚¬  I hear Emily plead. â€Å"Please don't.† â€Å"What? He's not – which, of course begs the question, why aren't you bangin' his brains out, little Emily Evans?† Truth be told, I want to know Emily's response. It's not like I haven't thought about it a thousand times, but I'm curious to know if she thinks about it too. â€Å"I have to – † then I hear footsteps rapidly retreating. I decide to make myself known and walk out of the hallway where I've been hiding since the conversation seems to be over. â€Å"Hey, Ethan, you just missed Emily.† The blonde motions down the hall in the direction Emily went. I follow. The sound hits me immediately as I near a classroom with an open door. Thankfully, it's a sound I haven't heard for a while, but hearing it now cuts me like a hot knife through cold butter. â€Å"Emily?† I call to her as I enter the nearly empty room. The desks and chairs are stacked, waiting patiently for another round of students in the fall. Emily looks up, red-faced and glassy-eyed. She regards me for a moment, then bursts into another round of sobs. For a second, I think about how ugly crying is. I think Emily is beautiful, but the way her face contorts†¦ it's just so unattractive. This crying mess in front of me doesn't look like Emily at all. Then the few remaining scraps of humanity I think I have left kick in, and those superficial and negative thoughts float away. All I'm seeing now is my Emily in pain – and I want to make it stop. I go to her as fast as my legs can carry me and take her in my arms, holding her close. We've only embraced a few times, but for me, it's special every time. After several minutes, Emily has calmed and she raises her head to look at me. Her eyes are clear now, and as she gazes into my eyes, I think about how beautiful she is. It's all I can do not to place my lips over hers. We're so close that just a few inches forward would connect us. I want her so much sometimes it's hurts. But that's not meant to be, and my sinful thoughts have to remain hidden. â€Å"Ethan, I have to tell you something. Well, ask you something, really. I mean I'm going to tell you something, but then I'm going to – † I cut her off by placing my hand gently over her mouth. She rambles when she's nervous, plus my hand will keep me from kissing her. â€Å"Deep breath,† I coach her and myself. After a few relaxing sighs, I encourage her to start again. â€Å"You can tell me anything, Emily. I'm here for you. You can trust me.† But never in a million years would I expect what she says next. â€Å"Ethan, I love you.†